2025-04-05 18:09:02, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_068108352 2529 bp mRNA linear VRT 04-SEP-2024 DEFINITION PREDICTED: Myxine glutinosa protein argonaute-1-like (LOC137421869), mRNA. ACCESSION XM_068108352 VERSION XM_068108352.1 DBLINK BioProject: PRJNA1152620 KEYWORDS RefSeq. SOURCE Myxine glutinosa (Atlantic hagfish) ORGANISM Myxine glutinosa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Cyclostomata; Myxini; Myxiniformes; Myxinidae; Myxininae; Myxine. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_090423) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_040869285.1-RS_2024_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/29/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2529 /organism="Myxine glutinosa" /mol_type="mRNA" /isolate="MG_SS" /isolation_source="wild captured" /db_xref="taxon:7769" /chromosome="2" /sex="hermaphrodite" /tissue_type="testes" /dev_stage="adult" /geo_loc_name="USA: Atlantic Ocean, Gulf of Maine" /collection_date="2011-10" gene 1..2529 /gene="LOC137421869" /note="protein argonaute-1-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 50 Proteins" /db_xref="GeneID:137421869" CDS 10..2529 /gene="LOC137421869" /codon_start=1 /product="protein argonaute-1-like" /protein_id="XP_067964453.1" /db_xref="GeneID:137421869" /translation="
MCSILEVFEPPARPSVGVLGSSISLRTNLFQLDIPKGVIHNYDVQVCPEKCPRRLNREVIQHMIKSYKQIFGETIPAYDGFKNLYTATPLPIGCDHVELEVILDGHVWSSRKFLVSLRWVAAVNFRLLHNSLVGQSAPVPRDSMIALDVIMQHLQSMRYTPVGRSFFSESMHHVHPLGFGREIWFGFHQSLRPAMWNVLLNVDVSATAFYKAQPVLDFLCDVLGLSSPFNRAFLTEAQHVTFSREIAGMKVEISHRGQSKRKYRVCSLSHKSADLQTFPLLMANGQRVECSVARYFRDKHKVQLRFPHLPCLHVGHREKHTFLPLEVCNVMAGQNCIRHLTDSQVSVMIRATAHSATDRQEEIAKQMKTLDFKSDPYTREFEIHVCDKMTDVIGRILPVPVLQYGGKTTVRPHRGIWDMRGKQFYSGIEIKVWALVCFSTRRYCSEQCLKSFTDRLQRISKDVGMPVEGQPCLCKYSHTLDNVELLFRHIKEAYAGLQLVLVVLPGKTPVYAEVKRVGDTFLGIATQCIQTKNVTGTSPQILSNLCLKINAKLGGVNNILLPHRCTSVFKQPAIILGGCLLHPQARDERSAIAAVVGSIDVYPSRYCSAIRFQQQGLVYVVDMAPIMRELLVQFYKATHFKPAKIIYYRKGVAEGQVPKVLYQELLSIREACIGLEEGYKPGITFIAVQKCHHTRLFCSNKAEHVGKSGNIPAGTIVDMKITHPTQFDFYLCSHLGIQGTSRPSHYHVLWDDNCFTADDLQLLTYHLCHTYVRCTRSVSIPAPTYYAQLVAFRARCYLMDKKNNDDSNQVKGQGNGRGLSELVKNAQLHKDTLRTMYFA"
misc_feature 244..462 /gene="LOC137421869" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 490..642 /gene="LOC137421869" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 643..999 /gene="LOC137421869" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(796..798,841..843,883..885,895..897,949..951, 970..972,976..978) /gene="LOC137421869" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1135..2403 /gene="LOC137421869" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1540..1542,1552..1554,1588..1599,1606..1608, 1630..1632,1639..1641,1651..1653,1663..1665) /gene="LOC137421869" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1744..1746,1750..1752,1957..1959,2371..2373) /gene="LOC137421869" /note="active site" /db_xref="CDD:240015" ORIGIN
gcgcgagacatgtgttcaatcttggaggtgttcgagcccccggcaagaccgagtgtgggtgtcctcggaagtagcatcagtctgcggacgaacctcttccagctggacatccccaaaggcgtcatccacaactatgacgtgcaagtctgtcccgaaaagtgtccacggagactcaacagagaggtcatccagcacatgatcaagtcctacaagcagatatttggcgagacaattcccgcctacgacggattcaaaaacctctacactgccacaccgctgcccattggatgtgaccatgtcgagctggaggtcatcttggatgggcacgtttggagtagtcgtaagttcttggtttctttgcgttgggttgctgccgtcaactttcgcctcctgcacaactctttggtcgggcagagtgctccggtgccccgtgactcgatgatcgctctcgatgtgataatgcaacatctgcaatcgatgaggtacacacctgtggggagatcatttttctctgaatccatgcatcatgtccacccgctgggatttggtcgagagatctggttcggcttccatcagtcgttacgaccagcgatgtggaacgtcctgctcaatgtcgatgtatcggctacagctttctacaaagcacaaccggtgttggactttctttgtgacgttcttggtctgtcatctccatttaatcgggcattcctcacagaagctcagcatgtcaccttcagcagggagattgcaggaatgaaggtggaaatttcacatcgtggacagtctaagcgcaaatatcgagtgtgcagcctttcccacaaatctgcagacctccaaacgttccctctgctaatggccaacggacaacgagtggagtgctcggtcgcgcgttacttccgtgacaagcacaaggtgcagctgcggttcccacacctgccctgcttgcatgttggccacagggaaaagcacactttcctcccactcgaggtgtgcaacgtgatggctggccaaaactgcattcgtcatctcaccgacagccaggtttctgtgatgatccgtgcgaccgctcactcggcgactgataggcaggaggagattgccaagcagatgaagaccctcgatttcaagtcggatccttacacaagggagtttgagattcatgtatgtgacaagatgactgacgtgatcggccgcatccttccagtacctgtgcttcaatatggaggcaagaccacagtgaggccccacagaggcatttgggacatgcgtggtaaacagttctacagtggcattgagatcaaagtgtgggccctggtttgcttctctacacgaagatactgcagtgagcaatgtctgaagagcttcacagatcggctgcagaggatctcaaaggatgtagggatgcctgtcgaaggtcagccatgcttgtgcaagtactcgcataccctcgataacgtggagcttctcttccgacacatcaaggaggcatatgccggcttacagcttgtccttgtggttcttccaggaaagacacctgtatacgccgaggtgaaacgtgtgggggacacgtttttgggaattgcgacacagtgcatccagacgaagaacgtgacaggtacatcacctcagattctgtcgaacctctgtctgaagatcaatgctaaactcgggggagtcaacaacattctgcttccacatcggtgcacatcggtgttcaaacagcccgcgatcatccttggaggatgtctattgcacccacaagccagagacgagcgatctgccattgccgcagtggtgggcagcatagatgtgtacccgagccgttactgcagtgcaattcgatttcagcaacagggactggtctatgtcgtggatatggcaccgatcatgcgtgagcttctcgtgcagttctacaaggcaacacacttcaaaccagcaaagatcatttattaccgcaaaggcgtggctgaagggcaggtaccaaaggttctctaccaagagctcctgtccatccgtgaagcgtgcattggtctggaggagggctacaagccaggcatcaccttcatcgctgtgcagaaatgccaccacacacgtctcttctgctcgaacaaggctgagcatgttgggaagagcggaaacattccagctggaactattgtcgatatgaaaatcactcaccccacgcaattcgatttctacctgtgtagccatttgggcatccagggaacgagccgcccatcacactaccatgtactctgggatgacaactgctttacagcagatgacctgcagctgctcacataccatctgtgccatacttatgtgcgttgcacacgctcagtttccatccctgcgcctacctactacgcacagcttgtggcctttcgtgctcgctgctacctcatggataaaaaaaacaatgacgatagcaaccaggtcaaaggtcaaggcaatggaagaggcttgagcgagcttgtgaagaatgcccaactacataaagacactttaagaacaatgtacttcgcctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]