2025-04-05 06:52:24, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_067888100 2643 bp mRNA linear PLN 29-AUG-2024 DEFINITION Phytophthora ramorum Protein argonaute PNH1 (KRP23_3271), partial mRNA. ACCESSION XM_067888100 VERSION XM_067888100.1 DBLINK BioProject: PRJNA1149793 BioSample: SAMN19730089 KEYWORDS RefSeq. SOURCE Phytophthora ramorum (sudden oak death agent) ORGANISM Phytophthora ramorum Eukaryota; Sar; Stramenopiles; Oomycota; Peronosporales; Peronosporaceae; Phytophthora. REFERENCE 1 (bases 1 to 2643) AUTHORS Carleson,N.C., Press,C.M. and Grunwald,N.J. TITLE High-Quality, Phased Genomes of Phytophthora ramorum Clonal Lineages NA1 and EU1 JOURNAL Mol Plant Microbe Interact 35 (4), 360-363 (2022) PUBMED 35285670 REFERENCE 2 (bases 1 to 2643) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (27-AUG-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 2643) AUTHORS Carleson,N.C., Press,C.M. and Grunwald,N.J. TITLE Direct Submission JOURNAL Submitted (19-JUL-2021) Horticultural Crops Research Unit, USDA, 3420 NW Orchard Ave., Corvallis, OR 97330, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_027150649). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..2643 /organism="Phytophthora ramorum" /mol_type="mRNA" /isolate="Pr-102" /host="Quercus agrifolia" /db_xref="taxon:164328" /chromosome="Unknown" /mating_type="A2" /geo_loc_name="USA: California" /collection_date="2004" /genotype="NA1" gene <1..>2643 /locus_tag="KRP23_3271" /db_xref="GeneID:94223917" CDS 1..2643 /locus_tag="KRP23_3271" /codon_start=1 /product="Protein argonaute PNH1" /protein_id="XP_067747374.1" /db_xref="GeneID:94223917" /translation="
MQLNVNYFGISLAAAPAEIFKYHVTVERSPDLQADSKYGPSGADQKDESMGDEPKQERKDDKDVVMAEPSADAPPKQEARPERPLPRTLVRNVINAALHQYEGEFGGLRVVHDGMTALYSPAMLPWTARDFADVNPDGPSATPAPPAPPPSADGAPRRSFRGPRTFVVKMKLVETISTSSLEDYYSNPEVNVMPVLQALDVVARHLGAQRLIAVGRNFFTMKKTHSLKGGKELCWGYHQAIRLADHKLLMNVDQAATVFYAPGPLMQLAMAALRARGPDEVRDLSERDMKSLARALRKIEVVPTHRKDRKRAIFGVSAKPADRTIVSIKGEDMSVAAYFIAKYNMKLRYPDLPLVNVGSKRPGKENWLPIEVCEVAPGQRCANINDLDTAEIIRQTSQPPRNRKENIMEQIRQAGFENDPFLAAFGVKVDQRLESTEARVMEAPEVQYQNVSERPAGGQWSLNAKKFVEGVPVRNWGVIVAANTSERDVRNFVGKLTDLGDQRGLPFEDKNPVLIHQDQYRGAQVEELMKMCHQELERRNMGPPQILMVILPAKNSPVYGDVKRMSDTVLGLPSQCIASVNLPRANPQFCANVCLKINMKLKGKNAVLRDSLPLVSTAPTIIIGADVEHPRSGMGGRPSIAAVVASMDRYSAQYAARVAAQKASSDIQQLPSMLRELFLAYYDNTKRKPEHVIYYRDGVSEGQMFDILQTEMRALRKAFKMISEDYNPPVTFVVVNKRHHLRAFPVNQRDADRKGNVMPGTVIDTGVVNPHRFDFFLYGHSGIQGTTVPGHYTVLHDENNMSAEDIQRLTYHLGYTFSRCTRSVSFVTPVYYAHLAAARARFYLNEGSDGASTVGSYNSNVSSFEFADVHSNVLNRMFYT"
misc_feature 331..606 /locus_tag="KRP23_3271" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:465134" misc_feature 637..780 /locus_tag="KRP23_3271" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:462567" misc_feature 784..1128 /locus_tag="KRP23_3271" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature 1258..2532 /locus_tag="KRP23_3271" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1675..1677,1687..1689,1723..1734,1741..1743, 1765..1767,1774..1776,1786..1788,1798..1800) /locus_tag="KRP23_3271" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1876..1878,1882..1884,2089..2091,2500..2502) /locus_tag="KRP23_3271" /note="active site" /db_xref="CDD:240015" ORIGIN
atgcagctgaacgtcaactactttggcatctcgctcgccgcggccccggcggagattttcaaatatcatgtcacagttgaacgttcccccgacctgcaggcggactcaaagtatggtccttcgggcgccgaccaaaaagatgagagcatgggcgacgagccgaaacaagaacgaaaggatgacaaggacgttgtgatggccgagccatcggcagacgcgccgccaaagcaagaggcgagacccgaacgcccgttgcctcgtacactagtgcgcaacgtgattaacgcagcacttcaccaatacgaaggagaatttggaggtctgcgagtggtccacgacggcatgactgctctctattcgccggccatgctgccgtggactgcgagagatttcgcagacgttaacccggacggccccagtgccacaccggcacctcctgcaccacccccatcagctgacggcgcacctcgtcggagttttcgtggcccgaggacttttgtcgtcaagatgaagttggtggagaccatctccacgtccagtttggaggactattattccaacccggaggtgaacgttatgcctgttctccaggctcttgacgtggtggcacgtcatctcggtgctcaacgtctcattgctgtcgggcgtaacttctttacgatgaagaagacgcactcgctgaagggtggcaaggagctctgttggggctaccaccaagcgattcggctcgcagaccacaagctgctgatgaacgttgaccaagcagcaaccgtgttctacgcaccaggccctttgatgcagctcgctatggcagctctgcgggctcgtggccccgacgaagttcgcgacctgtcggagcgtgatatgaaatcgttggcacgcgcgctgcgcaagattgaggtggtgcctacgcaccgcaaagaccgcaagcgcgccattttcggggtgagtgccaagcctgctgaccggacgatagtgagcattaagggagaggacatgtccgttgctgcgtacttcattgccaagtacaacatgaaactgcgctatccggatctaccattggtgaacgttggcagcaagcgccctggaaaagaaaattggctgcccattgaggtttgcgaggttgctcctggacaacgttgcgccaacatcaacgacctggacacggcggaaatcattcgccagaccagtcagcctccgcgcaatcgcaaagagaatattatggagcaaattcgccaggcaggctttgagaacgacccgtttctggcggcatttggcgtcaaggtggaccaacgtcttgaatcaacggaagctcgcgtcatggaagcgcccgaagtccaataccagaatgtatcggagcgcccagcgggtggccagtggagtctcaatgcgaagaagttcgtcgagggtgttcctgttcgtaattggggagtgatcgttgcggctaataccagcgagcgcgacgtccgaaactttgttgggaagttgaccgacttgggagaccagcgtgggctcccatttgaggacaaaaatcccgtgctcatccaccaggaccagtaccgtggagcacaagtggaagagctcatgaaaatgtgccaccaagaactggagagacgaaacatgggcccaccacagatactcatggtgatcttgccggccaaaaactctcctgtttacggcgacgtcaagcgcatgtccgatacagtgctgggcctgccgagccaatgcattgcctctgtgaatcttcctcgagccaacccacaattctgcgcgaacgtgtgcctcaagatcaacatgaagctgaaaggaaagaacgcggtgctgcgtgactcgctcccactggttagcaccgcgcccacgataatcatcggagctgatgtggagcacccgcgctcgggcatgggtggccgtccgtccatcgctgccgttgtggcctccatggaccgctattcggcgcagtacgctgcgcgcgtggcagcgcaaaaggcctccagcgatattcaacagctcccaagtatgctgcgcgaactgttcctggcttattatgacaacaccaagcgcaaaccggagcacgtgatctactaccgcgatggagtgagcgagggccaaatgtttgacatcctgcagaccgaaatgcgggcgctacgcaaggcttttaagatgatatctgaggactacaaccctccagtcaccttcgtggtagtgaacaagcgccaccacctcagagcgttcccagtgaaccagcgtgatgccgaccgcaagggtaatgttatgcctggcacagtgatcgacaccggcgttgtgaacccgcatcgatttgactttttcctctacggccacagcggaatccagggcacgaccgtaccgggacattacacggtgctgcatgatgagaacaacatgtcggcggaggacattcaacgcctcacgtaccacctgggctacacgttctcgcgctgcactcgctccgtgtcgtttgtcactccggtttactatgcgcacttggctgcagcgcgtgctcgcttctatctgaacgagggctcggatggtgcctccacggtgggctcctacaactcgaacgtttccagcttcgagtttgctgacgtgcacagcaacgtcctcaaccgcatgttctacacttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]