GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-02-23 15:12:37, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_066224568             561 bp    mRNA    linear   PLN 02-JUL-2024
DEFINITION  Kwoniella europaea PYCC6329 uncharacterized protein (V865_000739),
            partial mRNA.
ACCESSION   XM_066224568
VERSION     XM_066224568.1
DBLINK      BioProject: PRJNA1105968
            BioSample: SAMN02412473
KEYWORDS    RefSeq.
SOURCE      Kwoniella europaea PYCC6329
  ORGANISM  Kwoniella europaea PYCC6329
            Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
            Tremellomycetes; Tremellales; Cryptococcaceae; Kwoniella.
REFERENCE   1  (bases 1 to 561)
  AUTHORS   Coelho,M.A., David-Palma,M., Shea,T., Bowers,K., McGinley-Smith,S.,
            Mohammad,A.W., Gnirke,A., Yurkov,A.M., Nowrousian,M., Sun,S.,
            Cuomo,C.A. and Heitman,J.
  TITLE     Comparative genomics of Cryptococcus and Kwoniella reveals
            pathogenesis evolution and contrasting modes of karyotype evolution
            via chromosome fusion or intercentromeric recombination
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 561)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (27-JUN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 561)
  AUTHORS   Coelho,M.A., David-Palma,M., Shea,T., Sun,S., Cuomo,C.A. and
            Heitman,J.
  TITLE     Direct Submission
  JOURNAL   Submitted (31-JAN-2024) Department of Molecular Genetics and
            Microbiology, Duke University, DUMC Box 3546, 317 CARL Building,
            Durham, NORTH CAROLINA 27710, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_089487).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..561
                     /organism="Kwoniella europaea PYCC6329"
                     /mol_type="mRNA"
                     /strain="PYCC6329"
                     /db_xref="taxon:1423913"
                     /chromosome="1"
     gene            <1..>561
                     /locus_tag="V865_000739"
                     /db_xref="GeneID:91099543"
     CDS             1..561
                     /locus_tag="V865_000739"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_066080665.1"
                     /db_xref="GeneID:91099543"
                     /translation="
MQDYFSLPIEPENPETEYIETRRSLESCITGISSLTERLGITLRHQQDDQSLLGIYRELQHTFEHTSTQFQQQKNLLDAIMTKLEFPAAEKTRRISPMGNESYLKEVEDARRMAEEFGSFIQASVYQATEDSPLGKAFQSYSKLKPQVDELTSQPWSNTEAGVAGSSNDVEMDDLADLLATKFTAA"
ORIGIN      
atgcaagactatttcagtttacccatcgagccggaaaaccccgagacggagtacatcgaaactcgaaggagtcttgagagctgcatcactggaattagcagcctcaccgaaaggttgggtattaccttgcgacaccaacaggatgaccaatctcttcttggtatatacagagaactccagcatactttcgaacatacatcaacgcagttccaacagcagaaaaacttattggacgctatcatgaccaagctcgagttccctgctgcggaaaagacaagaagaattagcccaatgggcaatgaaagctatctgaaagaggtagaggatgcacgtagaatggcagaagagttcggatcattcatacaagcttctgtatatcaagctacggaggatagtcctctgggcaaagccttccaatcctatagtaaattgaaaccccaagtcgatgagctgacatcgcaaccttggtcgaacaccgaagcaggggtagctggatcatcaaacgatgtcgagatggatgatttggctgatctacttgccaccaaattcacagcggcctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]