GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 19:36:58, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_065731321            2020 bp    mRNA    linear   VRT 13-JUN-2024
DEFINITION  PREDICTED: Cyrtonyx montezumae vimentin (VIM), mRNA.
ACCESSION   XM_065731321
VERSION     XM_065731321.1
DBLINK      BioProject: PRJNA1120874
KEYWORDS    RefSeq.
SOURCE      Cyrtonyx montezumae (Montezuma quail)
  ORGANISM  Cyrtonyx montezumae
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Odontophoridae; Cyrtonyx.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027071870) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_038088225.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/10/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2020
                     /organism="Cyrtonyx montezumae"
                     /mol_type="mRNA"
                     /isolate="F1298"
                     /db_xref="taxon:9017"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="heart"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Texas, Edwards Plateau"
                     /collection_date="2023-02-20"
     gene            1..2020
                     /gene="VIM"
                     /note="vimentin; Derived by automated computational
                     analysis using gene prediction method: Gnomon. Supporting
                     evidence includes similarity to: 46 Proteins"
                     /db_xref="GeneID:136045452"
     CDS             68..1450
                     /gene="VIM"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="XP_065587393.1"
                     /db_xref="GeneID:136045452"
                     /translation="
MSFSSSKNSSYRRMFGGSSRPSSGTRYITSSTRYSLGSSLRPSSARYVSASPGGVYATKATSVRLRSSMPPMRMHDAVDFTLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDIMRLREKLQEEMMQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQAQLQEQHIQIDMDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQEANEYRRQIQSLTCEVDALKGSNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRINMPIPTFASLNLRETNIESQPMVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"
     polyA_site      2020
                     /gene="VIM"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
cccttcttcgcccgccgcgctccgagccccgctcccggattacaaagcagctccgtaccgcgccgccatgagcttcagcagcagcaagaactcctcgtaccgccgcatgttcggcgggagcagccggcccagcagcggcacccgctacatcacgtccagcacccgctactcgctgggcagctccctgcggcccagcagcgcccgctacgtgtccgcctctcccggcggcgtgtatgccaccaaagcgacgtcggtgcggctgcggagcagcatgccgcccatgcggatgcacgacgccgtggacttcaccctggcggacgccatcaacacggagttcaaggcgaaccgcaccaacgagaaggtagagctgcaggagctcaacgaccgcttcgccaactacatcgacaaggtgcgcttcttggagcagcagaacaagatcctgctggccgagctggagcagctcaagggcaaaggcacgtcccgcctgggcgacctgtacgaggaggagatgcgggagctgcggcggcaggtggaccagctgaccaacgacaaggctcgcgtcgaggtggagcgcgacaacctggccgacgacatcatgcgtctgcgggagaagttgcaggaggagatgatgcagcgggaggaggccgagagcaccctgcagtccttccgacaggatgttgacaatgcctctctggcacgtcttgatcttgagcgcaaagttgagtctctgcaagaagaaattgtcttcttgaagaagcttcatgatgaggaaatccgggaactgcaggcccaactccaggaacagcacatccaaattgatatggatgtttctaagcctgatcttactgctgccctgcgtgatgttcgccaacaatatgaaagcgttgctgctaagaatcttcaggaagctgaagagtggtacaagtccaaatttgcagatctctctgaagctgctaataggaacaacgatgccctgcgccaggccaaacaagaagctaatgagtaccgcagacagatccagtctctcacctgtgaagttgatgcccttaaaggaagtaatgaatccctggagcgccagatgcgtgaaatggaagagaattttgctgttgaagctgctaactaccaagacactatcggccgcctgcaggatgagattcagaacatgaaggaagaaatggctcgccatcttcgtgagtaccaggacctgctgaatgtgaagatggctcttgatattgagattgctacctacagaaaactgctggagggagaagagagcaggattaacatgcctattccaacctttgcttctttgaatctgagagaaaccaacattgagtctcagccaatggttgacactcactcaaagaggacacttctaattaagaccgtggaaactagagatggacaggttattaatgaaacttcccagcatcatgatgacttggagtaaagctgaagtgaagatgcaaacttaatgcaggagaaattcttaccagcaaggttttaaaaagttcatgtcttaaaggaagaaacagctttcaagtgcctttctccagtttttccatgagcgcaagattattatgctaggaaataggtcttagatcttgcaaactgactctccctgaaggattagagtttacaatggagtctagtttacaaatagcaatatcttgtgctgcaatactgtttttaagtatctgaatttaataaaactgctttttccagcacagtatgagcaacctgtcgctacttcaataaatctttggaaaatggctcttgatgtgttctaatttaacttcatgactttctgcaaagccataacttaatgctggaattactgtacggttggcaactccagtactgattgtgtggaatattgttttccgattaactagtcaaactgtcttcccatttactgcttaggttttggaaccaattaaaatggactataactggcagatgcataatgtattgatacttcttatcagttgaataaaatgatacttcaagctaataaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]