2024-11-15 19:40:06, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_065399721 1815 bp mRNA linear VRT 17-MAY-2024 DEFINITION PREDICTED: Emys orbicularis vimentin (VIM), mRNA. ACCESSION XM_065399721 VERSION XM_065399721.1 DBLINK BioProject: PRJNA1107594 KEYWORDS RefSeq. SOURCE Emys orbicularis (European pond turtle) ORGANISM Emys orbicularis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira; Testudinoidea; Emydidae; Emys. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_088684) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_028017835.1-RS_2024_05 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 05/09/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1815 /organism="Emys orbicularis" /mol_type="mRNA" /isolate="rEmyOrb1" /db_xref="taxon:82168" /chromosome="2" /sex="male" /tissue_type="blood" /dev_stage="adult" /geo_loc_name="Italy: Reserve Naturale Monte Rufeno" /lat_lon="42.78473 N 11.88612 E" /collection_date="2019-08-01" /collected_by="Claudio Ciofi" gene 1..1815 /gene="VIM" /note="vimentin; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 89 Proteins" /db_xref="GeneID:135874789" CDS 101..1489 /gene="VIM" /codon_start=1 /product="vimentin" /protein_id="XP_065255793.1" /db_xref="GeneID:135874789" /translation="
MSTTMSSKSSYRRMFGGGSRPSTSGSRYITSSGRYSLGSAIRPGSSRLVSSSPGGVYATKSSALRLRSSLPPTRFMHDTVDFSLADAINTEFKANRTNEKVELQELNDRFANYIDKVRFLEQQNKILVAELEQLKGKGTSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLADDILRLREKLQEEMIQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIVFLKKLHDEEIRELQVQIQEQHIQIDVDVAKPDLTAALRDVRQQYESVATKNLQEAEEWYKSKFADLSEAATRNNDALRQAKQEANEYRRQIQTLTCEVDALKGTNESLERQMREMEDNFAVEAANYQDTIARLQDEIQNMKEEMARHLHEYQELLNVKMALDIEIATYRKLLEGEESRITMPIPTFASLNLRETNIESHPMVDTLSKRTLLIKTVETRDGQVINETSQHHDDLE"
polyA_site 1815 /gene="VIM" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
accgccgcgggcagctgccgccgctctccttcgcctctctcgctccagcagcagtcaccggacccaccacccctcggattacaaagcgccggccgccgccatgagcaccaccatgagcagcaagagctcgtaccgcaggatgttcggcggcggcagccgccccagcacctcgggcagccgctacatcacctcctccggccgctactcgctgggcagcgccatccgccccggcagcagccgcctggtctcctcctcgcccggcggcgtctatgccaccaagtcctcggccctgcggctgcggagcagcctgccccccacgcggttcatgcacgacaccgtggacttctcgctggccgatgccatcaacacggagttcaaggccaaccgcaccaacgagaaggtggagctgcaggagctgaacgaccgcttcgccaactacatcgacaaggtgcgcttcctggagcagcagaacaagatcctggtggccgagctggagcagctcaagggcaagggcacctcccgcctgggggacctctacgaggaggagatgcgggagctccgccggcaggtggaccagctcaccaacgacaaagccagggtggaggtggagagggacaacctggccgatgacatcctgaggctcagggagaagttgcaagaagagatgattcagcgagaagaagctgaaagcaccctgcaatctttcagacaggatgttgacaatgcctctctggcacgtcttgatcttgagcgcaaagttgagtccttgcaagaagagattgtcttcttgaagaagcttcatgatgaggaaatccgtgaactgcaggtccagattcaggaacaacacatccaaattgatgtggatgttgctaaaccagatctcactgctgccctgcgtgatgtccgtcagcagtatgaaagtgttgctactaagaatcttcaggaagctgaagaatggtacaagtccaagtttgcagatctctctgaagctgctactaggaacaatgatgccctacgtcaggccaaacaggaagctaatgagtaccgtagacaaatacagaccctcacctgcgaagttgatgcacttaaaggaactaatgaatccctggagcgccagatgcgtgaaatggaggacaactttgctgttgaagctgctaactatcaagacactattgcccgtctgcaggatgaaatccaaaacatgaaggaagaaatggctcgccatcttcatgagtaccaagaactgctgaatgtcaagatggctcttgatattgagattgctacatatagaaaactgttggagggagaggagagcagaattaccatgcctattccaacttttgcttccctgaacctgagggaaaccaacattgagtctcaccctatggttgacactctctcaaagaggacactcttaattaagactgttgaaaccagagatggacaggttatcaatgaaacttcccagcatcacgatgatctggagtgaaaaccctagagaaactgcacatttctcacttgtgcagtgaaaagattcttaccagcaaaatttaaaaagtccctgtcttaaaggaagaaacagcttaagtgcctttctgcagtttttccaaaagcgcaagattattatgctagagaataggtattagatcttgcaaactgactctccctgaaggtttagagtttacaatggagtctagtttacagatagcaatatcttgtgctgcaatactgtttaagtttctgaattcaataaaactgctttttccagcaaagtatgagcaatttcactgcttcaataaatatttggaaaatggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]