LOCUS       XM_064144053             985 bp    mRNA    linear   VRT 31-MAR-2024
DEFINITION  PREDICTED: Pogoniulus pusillus ClpB family mitochondrial
            disaggregase (CLPB), mRNA.
ACCESSION   XM_064144053
VERSION     XM_064144053.1
DBLINK      BioProject: PRJNA1092276
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Pogoniulus pusillus (Red-fronted tinkerbird)
  ORGANISM  Pogoniulus pusillus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves;
            Coraciimorphae; Piciformes; Lybiidae; Pogoniulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_087269) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_015220805.1-RS_2024_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/28/2024
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 2% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..985
                     /organism="Pogoniulus pusillus"
                     /mol_type="mRNA"
                     /isolate="bPogPus1"
                     /db_xref="taxon:488313"
                     /chromosome="6"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /geo_loc_name="Eswatini"
                     /collection_date="2019-07-03"
                     /collected_by="Alex Kirschel"
     gene            1..985
                     /gene="CLPB"
                     /note="ClpB family mitochondrial disaggregase; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 Protein"
                     /db_xref="GeneID:135175761"
     CDS             62..985
                     /gene="CLPB"
                     /codon_start=1
                     /product="mitochondrial disaggregase"
                     /protein_id="XP_064000123.1"
                     /db_xref="GeneID:135175761"
                     /translation="

MLPFLAALPPAPGLPRLLRARPRLPPARGPQGARQAAQGAAAPGRALRWAPVAARRRSEPGPQPAPSRGLRPQGPKGSPPRAAPGPGGGSPVPVGAGPWGTPTALGPGPEGTPRGGGLRLPVRALLPAPGPAGTLALPRPWPLGAQRGWQRGEDPRGDPFGAAVPALLALVASCYLQDHLSKEEALLEAARSNNPAEVNRLLQEGADVNARHKLGWTALMVAAISRNSSVLQLLLAAKADPNLGDDFSSVYEVAKERGLHSLEVLLAREEHFQHRLNARANFRGCSALHYAVLADDPRGVSLLLATG"

     misc_feature    <614..>982
                     /gene="CLPB"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    614..697
                     /gene="CLPB"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    order(620..625,632..640,644..649,659..661,668..670,
                     695..697,701..703,707..709,719..724,731..739,743..748,
                     758..760,767..769,794..796,800..802,914..916,926..931,
                     938..946,950..955,965..967)
                     /gene="CLPB"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    701..796
                     /gene="CLPB"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
ORIGIN      

ggaggaggaggaggaggaggatggcagcggcgtccgcggcctagccggcagccggagcgcgatgctgccgttcctggccgccctgccgcccgccccgggcctgccgcggctcctccgggcccgcccgcgcctgccgccggcacgggggcctcagggcgctcggcaggcagcgcagggagcggcggcccccggcagggcgctgcggtgggcgccggtggccgccaggcggcgctccgagcccggcccgcagccagcgcccagccgggggctgcggccgcagggtcctaaaggcagccctccgcgagcggcgcccggccccgggggggggtccccggtaccggtgggggcaggcccctggggcacccccacagcgctggggccgggccccgaggggaccccgagagggggcggcctgaggctgccggtgcgggccctgctgcccgcccccggcccggctggcaccttggcactgccccggccctggcctctgggcgcccagcgtggctggcagcgtggagaagacccccggggggaccccttcggagcggctgtgcctgcgctgctggccctggtggcctcctgctacctccaggaccacctctccaaagaagaagctctgctggaggctgccaggagcaacaaccctgctgaggtcaacaggctgctgcaggaaggtgcagatgtcaacgccaggcacaagctgggctggacagctctgatggtggcagccatcagcaggaactccagcgtgctgcagctgctgctggcagccaaagcagacccaaaccttggagatgacttcagcagtgtctatgaggtggccaaggagagaggcctgcactccctggaagtgctgctggcccgggaggagcacttccagcaccgcctcaacgccagggccaacttcaggggctgcagcgccctgcactacgccgtgctggcagacgacccccgcggcgtcagcctgctgctggccacagggtaa

//