2024-11-15 16:40:29, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_028846928 1230 bp mRNA linear PRI 26-APR-2019 DEFINITION PREDICTED: Macaca mulatta mucin 21, cell surface associated (MUC21), mRNA. ACCESSION XM_028846928 VERSION XM_028846928.1 DBLINK BioProject: PRJNA528504 KEYWORDS RefSeq. SOURCE Macaca mulatta (Rhesus monkey) ORGANISM Macaca mulatta Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_041757.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Macaca mulatta Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1230 /organism="Macaca mulatta" /mol_type="mRNA" /isolate="AG07107" /bio_material="Coriell:AG07107" /db_xref="taxon:9544" /chromosome="4" /sex="female" /tissue_type="fibroblast" gene 1..1230 /gene="MUC21" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 Proteins, and 19% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:714502" CDS 1..1230 /gene="MUC21" /codon_start=1 /product="mucin-21" /protein_id="XP_028702761.1" /db_xref="GeneID:714502" /translation="
MKMQKGNVLLTFCLLLHLEAAINPSGTSTSANTGPTVTSSGISTVMNSGPSVTSSGASTATNSASSTTSGGASTATNSESSTATSSEFSTTSSGASTATSSEFSTTSSGASTATSSDSSTPSSGASTATSSDSSTPSTGASTATSSDSSTPSSGASTATSSDSSTTSSGASTVTSSDSSTTSGGTSTATSSESSNLRGPAHTATSSESSTNSGGTSTATSSESSTPSGGASTATSSESSTPSSGAGTATSSESSTTSTGASTATSSDSSTPSSGASTATSSGSSVTSAGSGTPTLTGTHTTSHRVITSASTAVSGAKPGGSLLPWEIFLITLVSVVAAVGLFAGLFFCVRNSLSLRNIFNTAVYRPHGLGPGPGGNRGAPHRPRWSPNWFWRRPVSSIAMEMSGRNNGP"
misc_feature 55..228 /gene="MUC21" /note="Tandem-repeating region of mucin, epiglycanin-like; Region: Epiglycanin_TR; pfam05647" /db_xref="CDD:461702" misc_feature 925..1185 /gene="MUC21" /note="Mucin, catalytic, TM and cytoplasmic tail region; Region: Epiglycanin_C; pfam14654" /db_xref="CDD:434100" ORIGIN
atgaagatgcagaaaggaaatgttctccttacattttgtctactattgcatttagaagccgcaataaatcccagtgggactagcacctctgccaacactggacccactgtgacctccagtgggatcagcacagtcatgaactctgggcccagtgtgacctccagtggggccagcacagccaccaactctgcgtccagcacaacctccggcggggccagcacagccaccaactctgagtccagcacagccaccagctctgagttcagcacaacctccagtggggccagcacagccaccagctctgagttcagcacaacctccagtggagccagcacagccaccagctctgactccagcacaccctccagtggggccagcacagccaccagctctgactccagcacaccctccactggggccagcacagccaccagctctgactccagcacaccctccagtggggccagcacagccaccagctctgactccagcacaacctccagtggggccagcacagtcaccagctctgactccagcacaacctccggtgggaccagcacagccaccagctctgagtccagcaacctccgtgggccagcacacacagccaccagctctgagtccagtacaaactccggtgggaccagcacagccaccagctctgagtccagcacaccctccggtggggccagcacagccaccagctctgagtccagcacaccctccagtggggccggcacagccaccagctctgagtccagcacaacctccactggggccagcacagccaccagctctgactccagcacaccctccagtggggccagcacagccaccagctctgggtccagtgtgacctccgcaggctctggaacacccactctgactgggacgcacacaacttcccacagagttatcacaagtgcctctactgcagtgagtggggcgaagcctggggggtccctgctgccatgggaaatcttcctcatcacgctggtctcggttgtggcggccgtggggctgtttgctgggctcttcttctgtgtgagaaacagcctgtccctgagaaacatctttaacacagctgtctaccgcccccatggccttggcccaggccctggagggaatcgtggagccccccacaggcccaggtggagccctaactggttctggaggagaccagtatcctcgatagccatggagatgagcgggaggaacaacggaccctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]