LOCUS       XM_020761822            2833 bp    mRNA    linear   INV 10-APR-2017
DEFINITION  PREDICTED: Orbicella faveolata protein argonaute-2-like
            (LOC110055433), partial mRNA.
ACCESSION   XM_020761822
VERSION     XM_020761822.1
DBLINK      BioProject: PRJNA381078
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Orbicella faveolata
  ORGANISM  Orbicella faveolata
            Eukaryota; Metazoa; Cnidaria; Anthozoa; Hexacorallia; Scleractinia;
            Faviina; Merulinidae; Orbicella.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018149549.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Orbicella faveolata Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 1% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..2833
                     /organism="Orbicella faveolata"
                     /mol_type="mRNA"
                     /isolate="FL"
                     /db_xref="taxon:48498"
                     /chromosome="Unknown"
                     /sex="hermaphrodite"
                     /tissue_type="whole organism"
                     /dev_stage="adult"
                     /geo_loc_name="Panama"
                     /collection_date="Aug-2013"
                     /collected_by="Nancy Knowlton"
                     /identified_by="Nancy Knowlton"
     gene            <1..2833
                     /gene="LOC110055433"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 35 Proteins, and 96% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:110055433"
     CDS             <1..2091
                     /gene="LOC110055433"
                     /codon_start=1
                     /product="protein argonaute-2-like"
                     /protein_id="XP_020617481.1"
                     /db_xref="GeneID:110055433"
                     /translation="

LPTENSKDKTFKVTVKWVAQVSLFALEQALEGKHNQIPFETIQALDVVLRHLPSMKYTPVGRSFFSPPDGYYHPLESGREVWFGFHQSVRPSQWKMMLNIDVSATAFYKCQPVVEFMCEVLRKQQQELHQHKPLSDAERLKFTREIKGLKVEITHCGTTKRKYRVINVTKLPAQTLKFPLKQSEAGQAQEITVAKYFQEKHVKQLQFPHLPCLQVGQEQKHTYLPLEVCNLVAGQRCIKKLSDMQTSKMIRATAKKAPDREQEIVNLVRKADFNNDQYVQDFGISINDRMVELEGRVLIAPKLQYGGKDKIKISPRQGAWDMRGKQLFHGIEIKVWAIACFVSPQDCNDRALKSFAHQLMKISGETGMPIRSEPCFCKYAKKPTDVEPMFKHLMATFSNLQLIILVLPGKTPVYAEVKRVGDTMLGIATQCVQSKNVMKLNPQTISNLCLKINAKLGGINSILAPDVRIAAVVGSMDAHPSRYCASVRVQTHRQEIIAELAAMVRELLIQFYRSTRHKPVRIIFYRDGVSEGQFRQVLCHELKAIREACIKLEVGYQPGITFVVVQKRHHTRFFCQDEKDRCGNSGNVPPGTTVDIGITHPTEFDFYLCSHAGIQVKISNILSEVNQRQRPGPQYTGDIHMSIGHCAQNPDMILLFYCSHDNGSSCSGGHGDERSPQILAKAVQVHSEMLKGMYFA"

     misc_feature    <19..147
                     /gene="LOC110055433"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    175..327
                     /gene="LOC110055433"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    331..696
                     /gene="LOC110055433"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(487..489,532..534,577..579,589..591,643..645,
                     664..666,670..672)
                     /gene="LOC110055433"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    829..1845
                     /gene="LOC110055433"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1240..1242,1252..1254,1288..1299,1306..1308,
                     1330..1332,1339..1341,1351..1353,1363..1365)
                     /gene="LOC110055433"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
ORIGIN      

cttccaactgaaaacagcaaagacaagacattcaaagtgacagtcaaatgggtcgcacaagtaagcttgtttgccctggaacaagcattagaaggaaaacacaatcagattccgtttgagaccatccaggctctggatgttgtgttgcgccacttgccatccatgaagtatacccctgtggggagatctttcttttctcctccagatggctattaccacccactagaaagtgggcgtgaggtttggtttggctttcatcagagtgtgcgaccgtcacagtggaagatgatgctgaatattgatgtgtcagcaacagcattttataagtgtcagcctgtagtcgagttcatgtgcgaagttcttcgtaaacagcaacaggaacttcaccagcataagccgctatctgatgcagaaagactgaagttcaccagggagatcaaaggtttgaaggttgagatcacacactgtggtactacgaagagaaagtatcgggtaatcaatgtcacaaaactaccagcacaaactctgaagtttcctctcaagcagtcagaagcagggcaggcccaggagatcacagtggcaaagtattttcaggaaaaacacgtgaaacaactccaattcccccacctgccttgtcttcaggtcggacaggaacagaaacacacctacctacctttagaagtttgtaaccttgttgctggacagcgctgcatcaagaagttgtctgacatgcagacgtccaagatgatcagagctactgcaaagaaagctcctgatagagaacaggaaattgtaaatctggttaggaaagcagattttaacaacgaccaatatgttcaagattttggcatctcaataaatgacagaatggttgaactcgaaggtcgtgttcttatcgcccctaaactacaatatggaggaaaggacaaaataaagatttctccaagacaaggtgcctgggacatgcgaggaaagcagctgtttcacggcatcgagataaaggtctgggcgattgcttgctttgtaagtcctcaagactgcaacgacagagctttgaagagcttcgcgcatcagttgatgaagataagtggcgaaactggaatgcccatcagatctgagccttgtttctgtaaatatgccaagaaacctacagatgttgaaccgatgttcaagcacttgatggcgacgtttagcaatttacagcttattatcctcgtcttacctggaaaaactccagtctatgctgaagtcaagcgtgttggggatacaatgttgggtattgctacacagtgtgtgcagtcgaaaaatgtcatgaaattaaacccacaaaccatttccaatctctgcctcaaaatcaacgctaagcttggtggaataaacagcatcctcgctcctgatgtgcgaattgctgctgttgtcggcagtatggatgcccatcctagccgatattgtgcttctgtgcgagtgcaaacgcatcgacaggaaatcattgccgagttagccgccatggtacgggagctgttgattcagttttatcgctcgacgagacacaaaccagtgcggattattttttatcgagatggagtgagtgaagggcagtttagacaggtcctgtgccacgaactgaaggcaatccgcgaggcttgcatcaagctggaggttgggtaccagcctggaatcacgttcgttgtggtccaaaagcgacatcacacacgattcttctgtcaggacgaaaaagaccggtgtggcaacagtgggaatgtccctccaggtaccactgtggatatcggcatcacacatcccactgagtttgacttctacctgtgcagtcacgcaggtattcaggtaaagataagcaatatactctcagaagttaaccagagacagaggcccggtccacaatacactggagatattcatatgagtattgggcattgcgcacaaaatcctgacatgatacttttgttttattgtagtcacgacaacggttcatcgtgtagcggtgggcatggagatgaacgaagtccgcagatattggccaaagctgttcaagttcactctgaaatgttgaaagggatgtactttgcctgagggcactctgtgtgatatacacaacacttacaaccacgactcttttagactatttattctttttgacaatgtggcaaatacttcatgtatctaccctgtggtgtagttttatctcttttactataaaatgttcgccgtatttttggctttaagacacctatttgaaaaacaagcgaacatgttgtttctttgaaagaaatcagatgaggaaagtagaattcttgaagactgggtttgcttagatgcgcttctccatttcttttccgcgcgcgcttcttgtgatgaagtgtgatatgcaaattagctatgaaatggtatctaatgcgcatgtgcaccagctgactgtgtccctttaagaaacacttggattgaaaatcactgattatgtcggctcgactataaaatttttatagagcatataagttagcctaatgtatttttaaaactttcgttacaatgaattctgtaagtgtgatataatgatctagaaaatttttagagtaggttttatcgtgctgtgcacgtcatacttagaatttaggtcagtactctatccaatcgtcattttaagattacaagtagcacattgcctaagaggtgatttatgaaatatatgtcaaagcaacaaaacaaattgaaataaataacgtgtaacttgaacctaagttgtgtgagaagaagcggaaagtacttttccaaaactacctgcattctaacaataaaaagcaccaaggaccgtaca

//