2025-04-22 02:18:06, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_014882943 792 bp mRNA linear VRT 02-DEC-2015 DEFINITION PREDICTED: Sturnus vulgaris alkaline ceramidase 1 (ACER1), mRNA. ACCESSION XM_014882943 VERSION XM_014882943.1 DBLINK BioProject: PRJNA304638 KEYWORDS RefSeq. SOURCE Sturnus vulgaris (Common starling) ORGANISM Sturnus vulgaris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves; Passeriformes; Sturnidae; Sturnus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_014650615.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Sturnus vulgaris Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..792 /organism="Sturnus vulgaris" /mol_type="mRNA" /isolate="715" /db_xref="taxon:9172" /chromosome="Unknown" /sex="male" /dev_stage="adult" gene 1..792 /gene="ACER1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 8 Proteins" /db_xref="GeneID:106857101" CDS 1..792 /gene="ACER1" /codon_start=1 /product="alkaline ceramidase 1" /protein_id="XP_014738429.1" /db_xref="GeneID:106857101" /translation="
MPSIFSYQSAEVDWCENNFERSAVIAEYYNTISNVSFFVLSPALLYLNRQYCQKKALPLYFVSGLLLLVGVFSMYFHMTLSYVGQLLDELSILWTLAVAYSFWYPQAYFPKCIKTRRHFFWLTGITTVISTLMSFIKPTLNAYALNCIAFHLLYMTWKELKKCNDKRVHRMAAVMVMWWVLAITSWISDRWLCWLWQAINFPYFHSFWHVLIAMSLLYCCPLVIYFDVTYEMPSFKPKLEYWPSDSWPVVVPYVTLEESHKQC"
misc_feature 16..753 /gene="ACER1" /note="Region: Ceramidase; pfam05875" /db_xref="CDD:461766" ORIGIN
atgccgagcatattttcctaccagagtgccgaggtggattggtgtgagaacaacttcgagcgctcggcggtgattgccgagtactacaacaccatcagcaatgtgagtttctttgtgctgtcccctgcactgctgtacctgaacaggcagtactgccagaagaaggctctgcccctctactttgtgtcggggctgctcctcctcgtaggtgtcttctccatgtacttccacatgaccctgagctacgtgggtcagctcttggatgaactctccatcctctggacactggctgtggcttattccttctggtacccacaggcttacttccccaagtgcatcaagaccaggagacatttcttctggctgactgggatcaccaccgtcatcagcaccttgatgtctttcatcaagccgaccctcaatgcctacgcactgaactgcatcgccttccacctgctctacatgacctggaaggagctcaagaagtgcaatgacaaacgtgttcaccggatggctgcagtcatggtgatgtggtgggtactggccatcaccagctggatcagtgaccgctggctctgctggctctggcaggccatcaacttcccctacttccacagcttctggcacgtgctgatagccatgtccctgctctactgctgccccctggtcatctacttcgacgtcacctacgagatgccctcgttcaagccaaagctggaatactggcccagtgactcgtggcctgttgtggtgccctatgtcaccctagaggaatcccacaagcagtgctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]