GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 16:34:58, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_005835546            1626 bp    mRNA    linear   PLN 24-OCT-2013
DEFINITION  Guillardia theta CCMP2712 hypothetical protein (GUITHDRAFT_136715)
            mRNA, complete cds.
ACCESSION   XM_005835546
VERSION     XM_005835546.1
KEYWORDS    RefSeq.
SOURCE      Guillardia theta CCMP2712
  ORGANISM  Guillardia theta CCMP2712
            Eukaryota; Cryptophyceae; Pyrenomonadales; Geminigeraceae;
            Guillardia.
REFERENCE   1  (bases 1 to 1626)
  AUTHORS   Curtis,B.A., Tanifuji,G., Burki,F., Gruber,A., Irimia,M.,
            Maruyama,S., Arias,M.C., Ball,S.G., Gile,G.H., Hirakawa,Y.,
            Hopkins,J.F., Kuo,A., Rensing,S.A., Schmutz,J., Symeonidi,A.,
            Elias,M., Eveleigh,R.J., Herman,E.K., Klute,M.J., Nakayama,T.,
            Obornik,M., Reyes-Prieto,A., Armbrust,E.V., Aves,S.J., Beiko,R.G.,
            Coutinho,P., Dacks,J.B., Durnford,D.G., Fast,N.M., Green,B.R.,
            Grisdale,C., Hempe,F., Henrissat,B., Hoppner,M.P., Ishida,K.-I.,
            Kim,E., Koreny,L., Kroth,P.G., Liu,Y., Malik,S.-B., Maier,U.G.,
            McRose,D., Mock,T., Neilson,J.A., Onodera,N.T., Poole,A.M.,
            Pritham,E.J., Richards,T.A., Rocap,G., Roy,S.W., Sarai,C.,
            Schaack,S., Shirato,S., Slamovits,C.H., Spencer,D.F., Suzuki,S.,
            Worden,A.Z., Zauner,S., Barry,K., Bell,C., Bharti,A.K., Crow,J.A.,
            Grimwood,J., Kramer,R., Lindquist,E., Lucas,S., Salamov,A.,
            McFadden,G.I., Lane,C.E., Keeling,P.J., Gray,M.W., Grigoriev,I.V.
            and Archibald,J.M.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Algal nuclear genomes reveal evolutionary mosaicism and fate of
            nucleomorphs
  JOURNAL   Nature (2012) In press
REFERENCE   2  (bases 1 to 1626)
  AUTHORS   Kuo,A., Curtis,B.A., Tanifuji,G., Burki,F., Gruber,A., Irimia,M.,
            Maruyama,S., Arias,M.C., Ball,S.G., Gile,G.H., Hirakawa,Y.,
            Hopkins,J.F., Rensing,S.A., Schmutz,J., Symeonidi,A., Elias,M.,
            Eveleigh,R.J., Herman,E.K., Klute,M.J., Nakayama,T., Obornik,M.,
            Reyes-Prieto,A., Armbrust,E.V., Aves,S.J., Beiko,R.G., Coutinho,P.,
            Dacks,J.B., Durnford,D.G., Fast,N.M., Green,B.R., Grisdale,C.,
            Hempe,F., Henrissat,B., Hoppner,M.P., Ishida,K.-I., Kim,E.,
            Koreny,L., Kroth,P.G., Liu,Y., Malik,S.-B., Maier,U.G., McRose,D.,
            Mock,T., Neilson,J.A., Onodera,N.T., Poole,A.M., Pritham,E.J.,
            Richards,T.A., Rocap,G., Roy,S.W., Sarai,C., Schaack,S.,
            Shirato,S., Slamovits,C.H., Spencer,D.F., Suzuki,S., Worden,A.Z.,
            Zauner,S., Barry,K., Bell,C., Bharti,A.K., Crow,J.A., Grimwood,J.,
            Kramer,R., Lindquist,E., Lucas,S., Salamov,A., McFadden,G.I.,
            Lane,C.E., Keeling,P.J., Gray,M.W., Grigoriev,I.V. and
            Archibald,J.M.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (02-NOV-2012) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_005434653).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1626
                     /organism="Guillardia theta CCMP2712"
                     /mol_type="mRNA"
                     /strain="CCMP2712"
                     /db_xref="taxon:905079"
                     /chromosome="Unknown"
     gene            <1..>1626
                     /locus_tag="GUITHDRAFT_136715"
                     /db_xref="GeneID:17305135"
     CDS             1..1626
                     /locus_tag="GUITHDRAFT_136715"
                     /codon_start=1
                     /product="hypothetical protein"
                     /protein_id="XP_005835603.1"
                     /db_xref="JGIDB:Guith1_136715"
                     /db_xref="GeneID:17305135"
                     /translation="
MFYFATTNTMFVSFRLNILNTQSEENSSACTSVFLFLGTHLLRAWQGFDWMVSYGAMAEKISDRPRAFTLTASIVLPILLVVHYAGASQYGEFDREALSARQTFARDSAGSLALRRMPLNLNSCYTATFLRKSSCFIRPLPGLSDHGVALHLRGGRRDKENTSDKESSLSESSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSSVSSSSTESSYESSDRLNPNMFSAEESSVKERRQRRHALREPKHRPAITHNSGAGALTTRSHTHQDEDEHEGHDDDEYSDDHHKDEEEGEEHSSDDESESEEDSEEDESSETEENSSEAEEESSESEEEESSESEEEESSEAEEEGSSEAEEEGSSEAEEEGSSEAEEEGSSESEEEESSEAEEEGSSEAEEEGSSEAEEEGSSEAEEEGSSEAEEEESSESEEEESSEAEEEGSSEAEEEGSSEAEEEGSSEAEEEGSSEADSEERSEYDSQDPDGVDGRRQ"
ORIGIN      
atgttctactttgcaaccaccaacacaatgtttgtatcatttcgtcttaacatcttgaacactcaatccgaagaaaacagcagcgcttgcacttctgtctttctcttcttagggactcacttgcttcgtgcttggcagggattcgactggatggtgtcttacggagcgatggcggagaaaatctcagatcgcccgagggcctttactcttacagcttctattgtgttgcccatcttacttgttgtgcactatgctggagcttcacagtacggtgaatttgacagggaggccttgtctgccaggcaaacgtttgcaagagattcagctggcagtctggctctgaggcgcatgccgttgaacttaaactcgtgttacactgcgacatttttgagaaagtcgtcttgcttcattagaccgcttcctggcctctctgaccacggtgtggcattgcacctgaggggtggacggcgcgataaagaaaatacttctgacaaagaatcaagtctgtctgagtcaagcacagattctactagcacagattctactagcacagattctaccagcacagattctaccagcacagattctactagcacagattctaccagcacagattctactagcacagattctactagcacagattctacaagcacagattcgaccagcacagattctaccagcacagattctaccagcactgattcgaccagcacagattctacaagcacagattctacaagcacagattctaccagcacagattctactagctctgtgtccagttcatcaacggaatcgagctatgaatcttcagatcgtcttaatcctaatatgttttcagctgaggaaagctcagtgaaggaaagacgacagaggcggcatgcattgagggaaccaaaacatcgtcccgcaatcactcataactctggcgctggagccttgaccaccaggagtcatacccaccaagatgaggacgagcatgagggtcatgacgacgacgaatacagcgatgaccatcacaaagacgaggaggaaggagaagaacattcatcggatgatgagtctgagtccgaggaagacagtgaggaggacgaaagctctgagactgaggagaatagctctgaggcggaggaggaaagctctgagtcagaggaggaggaaagctctgagtcagaggaggaggaaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgagtcagaggaggaggaaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggaggaaagctctgagtcagaggaggaggaaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagattccgaagagcgcagcgaatacgacagtcaagatccagatggagtggacggacgaagacagtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]