2024-11-15 16:34:58, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_005835546 1626 bp mRNA linear PLN 24-OCT-2013 DEFINITION Guillardia theta CCMP2712 hypothetical protein (GUITHDRAFT_136715) mRNA, complete cds. ACCESSION XM_005835546 VERSION XM_005835546.1 KEYWORDS RefSeq. SOURCE Guillardia theta CCMP2712 ORGANISM Guillardia theta CCMP2712 Eukaryota; Cryptophyceae; Pyrenomonadales; Geminigeraceae; Guillardia. REFERENCE 1 (bases 1 to 1626) AUTHORS Curtis,B.A., Tanifuji,G., Burki,F., Gruber,A., Irimia,M., Maruyama,S., Arias,M.C., Ball,S.G., Gile,G.H., Hirakawa,Y., Hopkins,J.F., Kuo,A., Rensing,S.A., Schmutz,J., Symeonidi,A., Elias,M., Eveleigh,R.J., Herman,E.K., Klute,M.J., Nakayama,T., Obornik,M., Reyes-Prieto,A., Armbrust,E.V., Aves,S.J., Beiko,R.G., Coutinho,P., Dacks,J.B., Durnford,D.G., Fast,N.M., Green,B.R., Grisdale,C., Hempe,F., Henrissat,B., Hoppner,M.P., Ishida,K.-I., Kim,E., Koreny,L., Kroth,P.G., Liu,Y., Malik,S.-B., Maier,U.G., McRose,D., Mock,T., Neilson,J.A., Onodera,N.T., Poole,A.M., Pritham,E.J., Richards,T.A., Rocap,G., Roy,S.W., Sarai,C., Schaack,S., Shirato,S., Slamovits,C.H., Spencer,D.F., Suzuki,S., Worden,A.Z., Zauner,S., Barry,K., Bell,C., Bharti,A.K., Crow,J.A., Grimwood,J., Kramer,R., Lindquist,E., Lucas,S., Salamov,A., McFadden,G.I., Lane,C.E., Keeling,P.J., Gray,M.W., Grigoriev,I.V. and Archibald,J.M. CONSRTM DOE Joint Genome Institute TITLE Algal nuclear genomes reveal evolutionary mosaicism and fate of nucleomorphs JOURNAL Nature (2012) In press REFERENCE 2 (bases 1 to 1626) AUTHORS Kuo,A., Curtis,B.A., Tanifuji,G., Burki,F., Gruber,A., Irimia,M., Maruyama,S., Arias,M.C., Ball,S.G., Gile,G.H., Hirakawa,Y., Hopkins,J.F., Rensing,S.A., Schmutz,J., Symeonidi,A., Elias,M., Eveleigh,R.J., Herman,E.K., Klute,M.J., Nakayama,T., Obornik,M., Reyes-Prieto,A., Armbrust,E.V., Aves,S.J., Beiko,R.G., Coutinho,P., Dacks,J.B., Durnford,D.G., Fast,N.M., Green,B.R., Grisdale,C., Hempe,F., Henrissat,B., Hoppner,M.P., Ishida,K.-I., Kim,E., Koreny,L., Kroth,P.G., Liu,Y., Malik,S.-B., Maier,U.G., McRose,D., Mock,T., Neilson,J.A., Onodera,N.T., Poole,A.M., Pritham,E.J., Richards,T.A., Rocap,G., Roy,S.W., Sarai,C., Schaack,S., Shirato,S., Slamovits,C.H., Spencer,D.F., Suzuki,S., Worden,A.Z., Zauner,S., Barry,K., Bell,C., Bharti,A.K., Crow,J.A., Grimwood,J., Kramer,R., Lindquist,E., Lucas,S., Salamov,A., McFadden,G.I., Lane,C.E., Keeling,P.J., Gray,M.W., Grigoriev,I.V. and Archibald,J.M. CONSRTM DOE Joint Genome Institute TITLE Direct Submission JOURNAL Submitted (02-NOV-2012) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_005434653). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1626 /organism="Guillardia theta CCMP2712" /mol_type="mRNA" /strain="CCMP2712" /db_xref="taxon:905079" /chromosome="Unknown" gene <1..>1626 /locus_tag="GUITHDRAFT_136715" /db_xref="GeneID:17305135" CDS 1..1626 /locus_tag="GUITHDRAFT_136715" /codon_start=1 /product="hypothetical protein" /protein_id="XP_005835603.1" /db_xref="JGIDB:Guith1_136715" /db_xref="GeneID:17305135" /translation="
MFYFATTNTMFVSFRLNILNTQSEENSSACTSVFLFLGTHLLRAWQGFDWMVSYGAMAEKISDRPRAFTLTASIVLPILLVVHYAGASQYGEFDREALSARQTFARDSAGSLALRRMPLNLNSCYTATFLRKSSCFIRPLPGLSDHGVALHLRGGRRDKENTSDKESSLSESSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSTDSTSSVSSSSTESSYESSDRLNPNMFSAEESSVKERRQRRHALREPKHRPAITHNSGAGALTTRSHTHQDEDEHEGHDDDEYSDDHHKDEEEGEEHSSDDESESEEDSEEDESSETEENSSEAEEESSESEEEESSESEEEESSEAEEEGSSEAEEEGSSEAEEEGSSEAEEEGSSESEEEESSEAEEEGSSEAEEEGSSEAEEEGSSEAEEEGSSEAEEEESSESEEEESSEAEEEGSSEAEEEGSSEAEEEGSSEAEEEGSSEADSEERSEYDSQDPDGVDGRRQ"
ORIGIN
atgttctactttgcaaccaccaacacaatgtttgtatcatttcgtcttaacatcttgaacactcaatccgaagaaaacagcagcgcttgcacttctgtctttctcttcttagggactcacttgcttcgtgcttggcagggattcgactggatggtgtcttacggagcgatggcggagaaaatctcagatcgcccgagggcctttactcttacagcttctattgtgttgcccatcttacttgttgtgcactatgctggagcttcacagtacggtgaatttgacagggaggccttgtctgccaggcaaacgtttgcaagagattcagctggcagtctggctctgaggcgcatgccgttgaacttaaactcgtgttacactgcgacatttttgagaaagtcgtcttgcttcattagaccgcttcctggcctctctgaccacggtgtggcattgcacctgaggggtggacggcgcgataaagaaaatacttctgacaaagaatcaagtctgtctgagtcaagcacagattctactagcacagattctactagcacagattctaccagcacagattctaccagcacagattctactagcacagattctaccagcacagattctactagcacagattctactagcacagattctacaagcacagattcgaccagcacagattctaccagcacagattctaccagcactgattcgaccagcacagattctacaagcacagattctacaagcacagattctaccagcacagattctactagctctgtgtccagttcatcaacggaatcgagctatgaatcttcagatcgtcttaatcctaatatgttttcagctgaggaaagctcagtgaaggaaagacgacagaggcggcatgcattgagggaaccaaaacatcgtcccgcaatcactcataactctggcgctggagccttgaccaccaggagtcatacccaccaagatgaggacgagcatgagggtcatgacgacgacgaatacagcgatgaccatcacaaagacgaggaggaaggagaagaacattcatcggatgatgagtctgagtccgaggaagacagtgaggaggacgaaagctctgagactgaggagaatagctctgaggcggaggaggaaagctctgagtcagaggaggaggaaagctctgagtcagaggaggaggaaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgagtcagaggaggaggaaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggaggaaagctctgagtcagaggaggaggaaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagaggaggagggaagctctgaggcagattccgaagagcgcagcgaatacgacagtcaagatccagatggagtggacggacgaagacagtaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]