GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 20:47:52, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NM_022937               1447 bp    mRNA    linear   ROD 30-MAR-2024
DEFINITION  Rattus norvegicus double C2 domain alpha (Doc2a), mRNA.
ACCESSION   NM_022937
VERSION     NM_022937.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1447)
  AUTHORS   Yao,J., Gaffaney,J.D., Kwon,S.E. and Chapman,E.R.
  TITLE     Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter
            release
  JOURNAL   Cell 147 (3), 666-677 (2011)
   PUBMED   22036572
REFERENCE   2  (bases 1 to 1447)
  AUTHORS   Pang,Z.P., Bacaj,T., Yang,X., Zhou,P., Xu,W. and Sudhof,T.C.
  TITLE     Doc2 supports spontaneous synaptic transmission by a
            Ca(2+)-independent mechanism
  JOURNAL   Neuron 70 (2), 244-251 (2011)
   PUBMED   21521611
REFERENCE   3  (bases 1 to 1447)
  AUTHORS   Higashio,H., Nishimura,N., Ishizaki,H., Miyoshi,J., Orita,S.,
            Sakane,A. and Sasaki,T.
  TITLE     Doc2 alpha and Munc13-4 regulate Ca(2+) -dependent secretory
            lysosome exocytosis in mast cells
  JOURNAL   J Immunol 180 (7), 4774-4784 (2008)
   PUBMED   18354201
REFERENCE   4  (bases 1 to 1447)
  AUTHORS   Korteweg,N., Denekamp,F.A., Verhage,M. and Burbach,J.P.
  TITLE     Different spatiotemporal expression of DOC2 genes in the developing
            rat brain argues for an additional, nonsynaptic role of DOC2B in
            early development
  JOURNAL   Eur J Neurosci 12 (1), 165-171 (2000)
   PUBMED   10651871
REFERENCE   5  (bases 1 to 1447)
  AUTHORS   Nagano,F., Orita,S., Sasaki,T., Naito,A., Sakaguchi,G., Maeda,M.,
            Watanabe,T., Kominami,E., Uchiyama,Y. and Takai,Y.
  TITLE     Interaction of Doc2 with tctex-1, a light chain of cytoplasmic
            dynein. Implication in dynein-dependent vesicle transport
  JOURNAL   J Biol Chem 273 (46), 30065-30068 (1998)
   PUBMED   9804756
REFERENCE   6  (bases 1 to 1447)
  AUTHORS   Verhage,M., de Vries,K.J., Roshol,H., Burbach,J.P., Gispen,W.H. and
            Sudhof,T.C.
  TITLE     DOC2 proteins in rat brain: complementary distribution and proposed
            function as vesicular adapter proteins in early stages of secretion
  JOURNAL   Neuron 18 (3), 453-461 (1997)
   PUBMED   9115738
REFERENCE   7  (bases 1 to 1447)
  AUTHORS   Naito,A., Orita,S., Wanaka,A., Sasaki,T., Sakaguchi,G., Maeda,M.,
            Igarashi,H., Tohyama,M. and Takai,Y.
  TITLE     Molecular cloning of mouse Doc2alpha and distribution of its mRNA
            in adult mouse brain
  JOURNAL   Brain Res Mol Brain Res 44 (2), 198-204 (1997)
   PUBMED   9073161
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAXUCZ010000001.1.
            
            On Nov 27, 2020 this sequence version replaced NM_022937.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR26360194.1008666.1,
                                           SRR26643298.5260.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760383, SAMEA5760393
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-330               JAXUCZ010000001.1  190888919-190889248
            331-410             JAXUCZ010000001.1  190889604-190889683
            411-485             JAXUCZ010000001.1  190889861-190889935
            486-595             JAXUCZ010000001.1  190890046-190890155
            596-722             JAXUCZ010000001.1  190891289-190891415
            723-782             JAXUCZ010000001.1  190891495-190891554
            783-946             JAXUCZ010000001.1  190891637-190891800
            947-1028            JAXUCZ010000001.1  190891888-190891969
            1029-1125           JAXUCZ010000001.1  190892059-190892155
            1126-1447           JAXUCZ010000001.1  190892238-190892559
FEATURES             Location/Qualifiers
     source          1..1447
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q36"
     gene            1..1447
                     /gene="Doc2a"
                     /note="double C2 domain alpha"
                     /db_xref="GeneID:65031"
                     /db_xref="RGD:620518"
     exon            1..330
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     CDS             60..1271
                     /gene="Doc2a"
                     /note="doc2-alpha; double C2, alpha; double C2-like
                     domains, alpha"
                     /codon_start=1
                     /product="double C2-like domain-containing protein alpha"
                     /protein_id="NP_075226.1"
                     /db_xref="GeneID:65031"
                     /db_xref="RGD:620518"
                     /translation="
MRGRRGDRMTINIQEHMAINVCPGPIRPIRQISDYFPRRGPGPEGGGGGRGFGEAPAHLAPLALAPPAALLGATTPDDGAEVDSYDSDDTTALGTLEFDLLYDQASCMLHCRILRAKGLKPMDFNGLADPYVKLHLLPGACKANKLKTKTQRNTLNPVWNEELTYSGITDDDITHKVLRISVCDEDKLSHNEFIGEIRVPLRRLKPSQKKHFNICLERQVPLPSPSSMSAALRGISCYLKELEQAEQGPGLLEERGRILLSLSYSSRRHGLLVGIVRCAHLAAMDVNGYSDPYVKTYLRPDVDKKSKHKTCVKKKTLNPEFNEEFFYEMELSTLATKTLEVTVWDYDIGKSNDFIGGVSLGPGARGEAQKHWRDCLHQPDTAVERWHTLTSELPPAAGALPLA"
     misc_feature    60..335
                     /gene="Doc2a"
                     /note="propagated from UniProtKB/Swiss-Prot (P70611.1);
                     Region: Interaction with UNC13D and DYNLT1.
                     /evidence=ECO:0000250"
     misc_feature    336..707
                     /gene="Doc2a"
                     /note="C2 domain first repeat present in Rabphilin and
                     Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035"
                     /db_xref="CDD:176000"
     misc_feature    order(426..428,444..446,609..611,615..617,633..635)
                     /gene="Doc2a"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176000"
     misc_feature    711..1268
                     /gene="Doc2a"
                     /note="propagated from UniProtKB/Swiss-Prot (P70611.1);
                     Region: Interaction with UNC13D. /evidence=ECO:0000250"
     misc_feature    828..1226
                     /gene="Doc2a"
                     /note="C2 domain second repeat present in Rabphilin and
                     Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384"
                     /db_xref="CDD:176030"
     misc_feature    order(912..914,930..932,1092..1094,1098..1100,1116..1118)
                     /gene="Doc2a"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176030"
     exon            331..410
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            411..485
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            486..595
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            596..722
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            723..782
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            783..946
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            947..1028
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1029..1125
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
     exon            1126..1447
                     /gene="Doc2a"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cctacagaccccagccggccactccagctctacacccgtctcccagccagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcaggggcttcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccactgccctgggcacgctggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaacggcctggctgacccctatgtaaagctgcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaacccagtgtggaacgaggagctgacgtacagtggaatcacagatgacgacatcacccacaaggtgctcaggatctcggtctgtgatgaggacaagctgagtcacaatgaatttattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgtcaggtcccgcttccttcgccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctagagcaggcagagcagggacctgggctgttggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgctcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagacgtggataagaaatccaagcataagacgtgtgtaaagaagaagacgctgaacccggaatttaatgaggaattcttttatgagatggaactctccactctggctaccaagaccctggaagtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggagagactgtctacatcagccggacacagcagtggagcgctggcataccctgaccagcgagctgcccccagcagcaggggcgttgccgttggcctgaacagactgcagctgcccagcacaggccctctgcggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatgggtgggacgcccctgccccacactacctgtcttatttttgtgagtctctgtgaccgtgggtctatcttcttgtgagggatgtggagagctata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]