GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-15 19:59:00, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NM_001433273             718 bp    mRNA    linear   ROD 08-AUG-2024
DEFINITION  Rattus norvegicus reproductive homeobox 9 like 1 (Rhox9l1),
            transcript variant 2, mRNA.
ACCESSION   NM_001433273
VERSION     NM_001433273.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 718)
  AUTHORS   Borgmann,J., Tuttelmann,F., Dworniczak,B., Ropke,A., Song,H.W.,
            Kliesch,S., Wilkinson,M.F., Laurentino,S. and Gromoll,J.
  TITLE     The human RHOX gene cluster: target genes and functional analysis
            of gene variants in infertile men
  JOURNAL   Hum Mol Genet 25 (22), 4898-4910 (2016)
   PUBMED   28171660
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000021.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AW921168.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-109               JAXUCZ010000021.1  121425885-121425993
            110-141             JAXUCZ010000021.1  121426178-121426209
            142-437             JAXUCZ010000021.1  121426342-121426637
            438-483             JAXUCZ010000021.1  121427262-121427307
            484-718             JAXUCZ010000021.1  121428209-121428443
FEATURES             Location/Qualifiers
     source          1..718
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq35"
     gene            1..718
                     /gene="Rhox9l1"
                     /gene_synonym="Psx3"
                     /note="reproductive homeobox 9 like 1"
                     /db_xref="GeneID:100364002"
                     /db_xref="RGD:2321855"
     exon            1..109
                     /gene="Rhox9l1"
                     /gene_synonym="Psx3"
                     /inference="alignment:Splign:2.1.0"
     CDS             28..579
                     /gene="Rhox9l1"
                     /gene_synonym="Psx3"
                     /note="isoform 2 is encoded by transcript variant 2; rhox
                     homeobox family member 2-like; homeobox protein PSX3;
                     reproductive homeobox 9-like"
                     /codon_start=1
                     /product="reproductive homeobox 9 like 1 isoform 2"
                     /protein_id="NP_001420202.1"
                     /db_xref="GeneID:100364002"
                     /db_xref="RGD:2321855"
                     /translation="
MDTPQDSCQSFQKSLSLGAEVDPEQQHGGTAVVSEAREDATGVGEEGDEKEEEMEARYAGDGAYGPEDNNVQQEGDQHPNDQEQPQQEAAIPEGSRGQQAGNNLAHPRYSRTRFTPSQLRDLERLFQETRYPSLRTRKDIARWMGVEECDVQNWFRMRRSLFQRSRRVLLLCTLQPFPQNNSS"
     exon            110..141
                     /gene="Rhox9l1"
                     /gene_synonym="Psx3"
                     /inference="alignment:Splign:2.1.0"
     exon            142..437
                     /gene="Rhox9l1"
                     /gene_synonym="Psx3"
                     /inference="alignment:Splign:2.1.0"
     exon            438..483
                     /gene="Rhox9l1"
                     /gene_synonym="Psx3"
                     /inference="alignment:Splign:2.1.0"
     exon            484..718
                     /gene="Rhox9l1"
                     /gene_synonym="Psx3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gcaaggtcagatccagtgattttcgccatggacactcctcaagacagctgccaaagtttccaaaagtctctgagtctgggagctgaggtggacccggagcaacagcatggtgggactgcagtggtctcagaggctagagaggacgccacaggagtaggagaggagggagacgagaaggaagaagaaatggaagcaagatatgctggtgatggtgcttacggccccgaggacaacaacgtccagcaagaaggtgaccaacaccccaatgatcaagagcagcctcagcaagaggcagccattcctgagggcagcaggggtcaacaggctgggaacaacttggctcacccgcggtacagtcgcacgaggttcaccccgtctcagctgcgtgatctggagcgcctgttccaagagactcgctaccccagcttgcgaacaaggaaggacatcgcacgatggatgggagtggaggaatgtgatgtgcagaattggttccggatgagaagatctcttttccagagaagcaggagagtgctgcttctctgcactctgcaaccatttccccagaacaactcttcctgaagattttggagcagcacttgagtgccaacgcctgtcccagagccacatgaggaaggcttcttctgagccacccataatggccatgactacctttacttccctacagttatttgagcaataaagacgtggattctaagta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]