GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-19 09:54:42, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001129918            5682 bp    mRNA    linear   VRT 05-FEB-2024
DEFINITION  Xenopus tropicalis dicer 1, ribonuclease III (dicer1), mRNA.
ACCESSION   NM_001129918
VERSION     NM_001129918.2
KEYWORDS    RefSeq.
SOURCE      Xenopus tropicalis (tropical clawed frog)
  ORGANISM  Xenopus tropicalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Silurana.
REFERENCE   1  (bases 1 to 5682)
  AUTHORS   Klein,S.L., Strausberg,R.L., Wagner,L., Pontius,J., Clifton,S.W.
            and Richardson,P.
  TITLE     Genetic and genomic tools for Xenopus research: The NIH Xenopus
            initiative
  JOURNAL   Dev Dyn 225 (4), 384-391 (2002)
   PUBMED   12454917
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from EU338242.1.
            
            On Jul 18, 2009 this sequence version replaced NM_001129918.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: EU338242.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMD00028290, SAMD00028291
                                           [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..5682
                     /organism="Xenopus tropicalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:8364"
                     /chromosome="8"
                     /map="8"
     gene            1..5682
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="dicer 1, ribonuclease III"
                     /db_xref="GeneID:100170154"
                     /db_xref="Xenbase:XB-GENE-491114"
     CDS             1..5682
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /EC_number="3.1.26.3"
                     /note="dicer 1, ribonuclease type III"
                     /codon_start=1
                     /product="endoribonuclease Dicer"
                     /protein_id="NP_001123390.2"
                     /db_xref="GeneID:100170154"
                     /db_xref="Xenbase:XB-GENE-491114"
                     /translation="
MAGLQLMTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNSGSGKTFIAVLLSKELSYQIRGDFSKNTKRTVFLVNSEKQVSQQVSAVRTHTDLKVGEYSDQEKTQCWAKERWYLEFETHQVLVMTCHIFLNVLKSGNVSLSNINLLVFDECHLAIQDHPYREIMKICESCQPCPRILGLTASILNGKCDPRDLEEKIQKLEEILRSNAETATDLVVLDRYASQPCEIVLDCGPYIDKSGLYQRLLNELDEALNFLIDCNISTHSKERDSTLISKQILSDCQTVLLVLGPWCADKVAGMMVRELQKYIKHEQEELHRKFLLFTDTILRKIHALCEEHFSPASLDMKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDDDEDEEIEEKEKTETSFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEVEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPSEYRSYVQSKGRARAPISNYIMLADSDKIKAFEEDLKTYKAIEKILRNKCSKSIDCGNTESEPIVDDDEIFPPYVLRQDDGSPRVTINTAIGHINRYCARLPSDPFTHLAPKCKTREFPDGLYRSTLYLPINSPLRAPIVGPPMNCGRLADRAVALICCKKLHEIGELDDHLMPVGKETVKYEEELDLHDEEETSVPGRPGSTKRRQCYPKAIPECLRNSYPKPGQPCYLYVIGMVLTTPLPDELNFRRRKLYPPEDTTRCFGILTAKPIPQIPHFPVYTRSGEVTISIELKKSGFTLNLEQLELITRLHQYIFSHILRLEKPALEFKPTVADCAYCVLPLNVVNDSGTLDIDFKFVEDIEKSEARTGIPNTQYSAESPFIFKLEDYQDAVIIPRQVIYRNFDQPHRFYVADVYTDLTPLSKFPSPEYETFAEYYKTKYNLDLTNLNQPLLDVDHTSSRLNLLTPRHLNQKGKALPLSSAEKRKAKWESLQNKQILVPELCAIHPVPASLWRKAVCLPSILYRLHCLLTAEELRAQTAIDAGVGVKSLPDDFRYPNLDFGWKRSIDSKTFISNQSSSSVESESDCRLNKTTAPDSAASSAANSVIYMQINDQMSVNCTPPCQKSLSHLQTVCFSDDYKAINGISCNGLTNGDWEAESAACFQKDERITCKQEIPEKSTSFHVQNLPKENQPILKECTLSNSDGNVSKPTSDECPSTCTSDMHYDSGLSNRHSSKTLGPNPGLILQALTLSNASDGFNLERLEMLGDSFLKHAITTYLFCTYPDAHEGRLSYMRSKKVSNCNLYRLGKKKGSPSRMVVSIFDPPVNWLPPGYIVNQDKNSDKWESNETSGEDVMVNGKIDEDFDDEEDEDLMWRNPKEETDFDDDFLEYDQEHIKFIDSMLMGSGAFVKKIPLSSFAPPDQNYEWRAPKKPPLESSQFPCDFDDFDYSSWDAMCYLDPSKAVEEDDFVVGFWNPSEENCGADAGKQSISYDLHTEQCIADKSIADCVEALLGCYLTSCGERAAQLFLCSLGLKVLPEVRKLVTNTNVISASSSYQNSTRDNCTLTARTNTDLSSCKGIDYGYLKIPPRCMFEHPDAEKTLDHLISGFENFEKKINYPFKNKAYLLQAFTHASYHYNTITDCYQRLEFLGDAILDYLITKHLYEDPRQHSPGVLTDLRSALVNNTIFASLAVKYDYHKYFKAISPELFHVIDDFVQFQLEKNEMQGMDSELRRSEEDEEKEEDIEVPKAMGDIFESLAGAIYMDSGMSLETVWHVYYPMMQPLIEKFSANVPRSPVRELLEMEPETAKFSPAERTYDGKVRVTVEVVGKGKFKGVGRSYRIAKSAAARRALRSLKANQSQVPNS"
     misc_feature    94..687
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="DEXH-box helicase domain of endoribonuclease Dicer;
                     Region: DEXHc_dicer; cd18034"
                     /db_xref="CDD:350792"
     misc_feature    order(94..105,112..114,163..186,307..309,496..498,
                     589..591)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350792"
     misc_feature    order(271..276,343..348,421..423,427..432,439..441,
                     514..522)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="nucleic acid binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:350792"
     misc_feature    493..504
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="propagated from UniProtKB/Swiss-Prot (B3DLA6.2);
                     Region: DECH box"
     misc_feature    781..1065
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="Partner-binding domain of the endoribonuclease
                     Dicer; Region: Dicer_PBD; cd15903"
                     /db_xref="CDD:277191"
     misc_feature    order(796..801,808..810,814..819,994..999,1006..1011,
                     1018..1020,1027..1032,1039..1041)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="Trbp binding interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:277191"
     misc_feature    1078..1665
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="C-terminal helicase domain of the endoribonuclease
                     Dicer; Region: SF2_C_dicer; cd18802"
                     /db_xref="CDD:350189"
     misc_feature    1198..1272
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="propagated from UniProtKB/Swiss-Prot (B3DLA6.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    order(1318..1326,1534..1536,1591..1593,1597..1599)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:350189"
     misc_feature    order(1546..1548,1552..1554,1627..1629,1633..1635)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350189"
     misc_feature    1861..2127
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="Dicer dimerization domain; Region: Dicer_dimer;
                     pfam03368"
                     /db_xref="CDD:460900"
     misc_feature    2152..2211
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="propagated from UniProtKB/Swiss-Prot (B3DLA6.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    2629..3006
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="PAZ domain, dicer_like subfamily. Dicer is an RNAse
                     involved in cleaving dsRNA in the RNA interference
                     pathway. It generates dsRNAs which are approximately 20 bp
                     long (siRNAs), which in turn target hydrolysis of
                     homologous RNAs. PAZ domains are named...; Region:
                     PAZ_dicer_like; cd02843"
                     /db_xref="CDD:239209"
     misc_feature    order(2827..2829,2866..2868,2884..2886,2896..2898,
                     2950..2952,2974..2976,2980..2982)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239209"
     misc_feature    3817..>4092
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="Ribonuclease III family; Region: RIBOc; smart00535"
                     /db_xref="CDD:197778"
     misc_feature    order(3868..3873,3880..3885,3892..3894,3901..3906,
                     3913..3918,3922..3930,3958..3960)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    4957..5451
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="Ribonuclease III C terminal domain. This group
                     consists of eukaryotic, bacterial and archeal ribonuclease
                     III (RNAse III) proteins. RNAse III is a double stranded
                     RNA-specific endonuclease. Prokaryotic RNAse III is
                     important in post-transcriptional...; Region: RIBOc;
                     cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(5017..5022,5029..5034,5041..5043,5050..5055,
                     5062..5067,5071..5079,5107..5109,5371..5373,5404..5406)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(5017..5019,5026..5028,5038..5040,5341..5343,
                     5350..5352)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(5026..5028,5341..5343,5350..5352)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    5329..5331
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="Important for activity. /evidence=ECO:0000250;
                     propagated from UniProtKB/Swiss-Prot (B3DLA6.2); other
                     site"
     misc_feature    5464..5652
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="double-stranded RNA binding motif of
                     endoribonuclease Dicer and similar proteins; Region:
                     DSRM_DICER; cd10843"
                     /db_xref="CDD:380680"
     misc_feature    order(5464..5469,5473..5478,5485..5490,5497..5502,
                     5512..5514,5527..5535,5539..5541,5545..5547,5596..5607,
                     5614..5616)
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /note="putative RNA binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:380680"
     exon            1..114
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            115..277
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            278..408
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            409..543
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            544..704
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            705..873
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            874..1349
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            1350..1482
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            1483..1725
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            1726..1880
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            1881..2013
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            2014..2089
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            2090..2229
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            2230..2409
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            2410..2623
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            2624..2786
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            2787..2969
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            2970..3075
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            3076..3251
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            3252..3981
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            3982..4134
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            4135..5008
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            5009..5277
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            5278..5440
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            5441..5516
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
     exon            5517..5682
                     /gene="dicer1"
                     /gene_synonym="dcr1; dicer; herna"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atggcaggccttcagctcatgactccggcctcctctccaatgggtcccttctttgggctaccctggcaacaggaggctattcatgacaacatttataccccacggaaatatcaggtggaactactcgaagcagcattggatcataatactatagtatgtttgaattctggctcagggaagacatttattgcagtactactcagtaaagagctgtcataccagatccgtggggacttcagcaaaaatactaagaggactgtgtttttggtcaattccgagaaacaggtttctcaacaagtgtctgctgtcaggacccatacagacctcaaggtgggagaatattcagatcaagaaaaaacacaatgctgggcaaaagaaagatggtacctagaatttgaaactcatcaggtcttggtcatgacctgccacatcttcctgaacgttctgaaaagtgggaacgtgtcattgtcaaacattaatctgttagtgtttgatgaatgtcatcttgcaattcaggatcacccatatcgagaaatcatgaagatatgtgagagttgccagccatgccctcgaatcctgggtctaactgcttcaattttaaatggaaaatgtgaccctcgtgacctagaggaaaagatccagaaactggaggaaatattaaggagtaatgcagaaactgcaactgatttggttgttttagacaggtatgcttcccaaccatgtgaaattgtattggactgtgggccatatattgacaaaagtggactttatcaaagacttctaaatgaattggatgaagcccttaactttctcattgactgtaatatttctacacattctaaagagagagattccacattaatttcaaaacagattctatcagactgtcaaactgttcttttggtcttgggaccatggtgtgctgataaagttgcggggatgatggtgagagagctgcagaagtatatcaaacatgagcaggaggaactgcacagaaaattccttttgtttacagacactatcttaaggaagatccatgctctttgtgaggaacacttctcgccagcctctcttgatatgaagtttgtcacacctaaagttataaaactgctggaaattttacgcaaatacaaaccctacgaacgccagcaatttgaaagtgttgaatggtataacaatagaaaccaggataattatgtgtcttggagtgattcagaggatgatgacgatgaagatgaagaaattgaggagaaagagaaaactgaaacaagctttccatccccattcacaaacatcctgtgtggcatcatcttcgtggaacgaagatacacagcagtagtattaaacaggttgattaaagaagccgggaagcaagatccagagctggcctatatcagtagtaactttattactgggcacggcataggaaagaaccagccacgcaataagcagatggaagttgagtttagaaagcaagaagaggtgcttcgtaaatttcgtgcacacgaaaccaacttattgatagctactagcattgttgaggaaggagtggacataccaaaatgcaacttggtagttcgatttgatttaccttcagagtacagatcctatgtacagtccaaaggcagagcaagagcaccaatctcaaattacatcatgctagccgatagtgataaaattaaggcatttgaagaggaccttaaaacatacaaagcaattgaaaagattctgcggaacaaatgctcaaagtccattgattgtggaaatacagaatctgagcccattgtggacgatgatgaaatatttccaccatatgtgttgagacaggatgatggcagcccacgagttactatcaacaccgctattggacacattaacaggtactgtgctaggctacctagtgacccatttactcatcttgctcctaagtgcaaaacacgagagttccctgatggactttatcgctcaacactctacctgccaattaattctccacttagagcccccattgttggccctccgatgaattgtggaaggctagctgatagagctgtagctcttatatgctgtaaaaaactacatgaaattggtgaactggatgatcatttaatgccagttggcaaggaaactgtaaaatatgaggaggagcttgatttgcatgatgaggaagaaaccagtgttccaggcagaccaggatccacaaaaagaaggcagtgttatccaaaagctattcctgaatgtttacggaacagctaccccaagcctggtcagccttgttacttatatgtaataggaatggtattaaccactcctctaccagatgaacttaattttaggcgacggaagctgtatccccctgaagacacaacaagatgctttggaatactaactgccaaacccatacctcagattcctcactttcctgtctatactcgttcgggagaggtgaccatatcaattgaactaaagaagtctggttttacattaaacttagaacaacttgagctcattactagactccaccagtacattttttcacacattcttcgtcttgagaaacctgcactagaatttaaacccacagtagccgattgtgcctactgtgttctacctcttaacgttgtaaatgattctggcactttggacattgacttcaaatttgtagaagatattgagaaatcagaagcacgtactggtatacctaatacacagtattcagctgaaagtccttttattttcaaattagaagactaccaggatgctgttatcattccaaggcaagtaatatatcgaaattttgatcagccgcacagattttatgtagctgatgtatacactgatcttacaccgctcagcaagttcccttcccctgaatatgaaacctttgctgaatattacaaaacaaagtataacctcgatctcacaaacctcaatcagccacttttggatgtggaccacacatcatcaagacttaatttgctgactcctcgccatctgaatcagaaaggtaaagctctgccattaagcagtgctgaaaagagaaaagccaaatgggagagtttacaaaacaaacagatcctggttccagagctttgtgctatacatccagtcccagcatccttatggagaaaagctgtttgtttgccaagcatactttatcgattacattgcctccttacagcagaagagctgagagcgcaaacagctattgatgctggggtaggagtcaaatcgcttcctgatgatttccgatacccaaacttggattttggatggaaacgatctatagacagtaaaacattcatctctaatcaaagttcctcatcagtcgagagtgaaagtgactgcagactcaataaaaccacggcccctgacagtgctgcaagctcagctgctaattctgtaatctacatgcaaatcaatgaccaaatgtctgtgaactgcacaccaccatgtcaaaaatctctgagtcacctccaaacagtttgcttctcagatgattacaaagcaattaacggtatttcttgcaatggtcttaccaatggtgattgggaagcagaaagcgctgcatgtttccaaaaggacgaacggataacctgcaaacaggaaatacctgaaaaatctacctcgtttcacgttcagaatttacctaaggagaaccagcccatacttaaagaatgtactctgagcaactctgatggaaatgtcagcaaacctacctcagatgagtgccctagcacctgtacttcagacatgcattatgatagtgggctttccaataggcactcttcaaaaactcttggcccaaaccctggtcttatccttcaggccttgactctgtccaatgcaagtgatggtttcaatctggagcgtcttgaaatgcttggggactctttcttaaaacatgctatcaccacatatctgttctgcacatacccagatgctcacgagggccgtctatcctatatgcgcagcaagaaggtcagtaactgtaacctttatcggcttggaaaaaagaaaggctcacccagccggatggtggtgtccattttcgatccacctgtcaactggcttccccctggttatattgttaaccaggacaaaaactctgataagtgggaaagtaatgaaacgtctggtgaggatgtgatggttaatggcaaaattgatgaagactttgatgatgaagaagatgaagatcttatgtggaggaatcccaaagaggaaactgattttgatgatgactttttggaatatgatcaagagcatataaaattcattgacagcatgttaatgggatctggggcatttgtgaagaaaattcctctttcttcatttgcaccccctgatcagaactatgaatggagggcgccaaagaaacctccactggaaagttctcaatttccctgcgattttgatgattttgattacagttcttgggatgccatgtgttatttggatcccagcaaggctgtagaggaggatgactttgtagtaggcttttggaatccatcagaagagaactgtggagctgatgctggaaagcagtctatatcttatgacctacacacagagcagtgtattgcagacaaaagtatagctgactgtgtagaggctttattaggctgctatctgaccagttgtggtgagagagctgcacaactgtttctttgttctttgggcttaaaagtgctcccagaagtaagaaagcttgttacaaacacaaatgtcattagtgcatcatcatcttaccagaacagtaccagagacaactgcactcttactgccagaaccaacactgatctgtcctcctgcaaaggcatagactacggttatttaaagattcccccaaggtgtatgtttgagcacccagatgctgagaaaacccttgaccatctaatatctggttttgaaaactttgagaagaaaataaactatccatttaaaaacaaggcttaccttctacaggcttttacacatgcctcttaccactacaatactataactgactgctaccagcgtttagaatttcttggagatgcaattttggactacctcattactaagcacctttatgaagatccacgccagcactcgccaggagtcctcactgacctgcgctctgctcttgtgaataacaccatatttgcatcactagctgtgaaatatgactaccataaatacttcaaggctatctctcctgaactgttccatgtaattgatgattttgtgcaatttcaacttgaaaaaaatgaaatgcaaggcatggattctgagttacgtaggtctgaagaagacgaagagaaagaagaggacattgaagtcccaaaagctatgggagacatatttgagtcacttgcaggagctatttacatggacagcggcatgtctttggaaactgtatggcatgtgtattatcctatgatgcagccattaatagaaaaattctctgctaatgttcctcgttccccagtgagagaattactggaaatggagcctgaaactgctaaattcagtccagccgaaagaacatacgatggaaaagtcagagtgactgtggaagttgttggaaaaggaaaatttaaaggagtcggaagaagttacagaattgccaaatctgcagcagccaggagagcactaagaagcctcaaagcaaatcaatctcaggtccctaacagctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]