2025-04-19 10:46:26, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001183991 921 bp mRNA linear PLN 17-DEC-2024 DEFINITION Saccharomyces cerevisiae S288C Cup9p (CUP9), partial mRNA. ACCESSION NM_001183991 VERSION NM_001183991.1 DBLINK BioProject: PRJNA128 KEYWORDS RefSeq. SOURCE Saccharomyces cerevisiae S288C ORGANISM Saccharomyces cerevisiae S288C Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces. REFERENCE 1 (bases 1 to 921) AUTHORS Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M., Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S., Weng,S. and Cherry,J.M. TITLE New data and collaborations at the Saccharomyces Genome Database: updated reference genome, alleles, and the Alliance of Genome Resources JOURNAL Genetics 220 (4) (2022) PUBMED 34897464 REFERENCE 2 (bases 1 to 921) AUTHORS Bussey,H., Storms,R.K., Ahmed,A., Albermann,K., Allen,E., Ansorge,W., Araujo,R., Aparicio,A., Barrell,B., Badcock,K., Benes,V., Botstein,D., Bowman,S., Bruckner,M., Carpenter,J., Cherry,J.M., Chung,E., Churcher,C., Coster,F., Davis,K., Davis,R.W., Dietrich,F.S., Delius,H., DiPaolo,T., Hani,J. et al. TITLE The nucleotide sequence of Saccharomyces cerevisiae chromosome XVI JOURNAL Nature 387 (6632 SUPPL), 103-105 (1997) PUBMED 9169875 REFERENCE 3 (bases 1 to 921) AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B., Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M., Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and Oliver,S.G. TITLE Life with 6000 genes JOURNAL Science 274 (5287), 546 (1996) PUBMED 8849441 REFERENCE 4 (bases 1 to 921) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (17-DEC-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 5 (bases 1 to 921) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (16-JAN-2015) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Protein update by submitter REFERENCE 6 (bases 1 to 921) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (31-MAR-2011) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Sequence update by submitter REFERENCE 7 (bases 1 to 921) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (14-DEC-2009) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA COMMENT REVIEWED REFSEQ: This record has been curated by SGD. This record is derived from an annotated genomic sequence (NC_001148). ##Genome-Annotation-Data-START## Annotation Provider :: SGD Annotation Status :: Full Annotation Annotation Version :: R64-4-1 URL :: http://www.yeastgenome.org/ ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..921 /organism="Saccharomyces cerevisiae S288C" /mol_type="mRNA" /strain="S288C" /db_xref="taxon:559292" /chromosome="XVI" gene <1..>921 /gene="CUP9" /locus_tag="YPL177C" /db_xref="GeneID:855926" CDS 1..921 /gene="CUP9" /locus_tag="YPL177C" /experiment="EXISTENCE:curator inference:GO:0005634 nucleus [PMID:9427760]" /experiment="EXISTENCE:direct assay:GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding [PMID:9427760]" /experiment="EXISTENCE:direct assay:GO:0043565 sequence-specific DNA binding [PMID:19158363]" /experiment="EXISTENCE:mutant phenotype:GO:0000122 negative regulation of transcription by RNA polymerase II [PMID:17005992|PMID:10850718|PMID:9427760|PMID:18708352]" /experiment="EXISTENCE:mutant phenotype:GO:2000877 negative regulation of oligopeptide transport [PMID:17005992]" /experiment="EXISTENCE:mutant phenotype:GO:2000879 negative regulation of dipeptide transport [PMID:10850718|PMID:9427760|PMID:17005992|PMID:18708352]" /experiment="EXISTENCE:physical interaction:GO:0061629 RNA polymerase II-specific DNA-binding transcription factor binding [PMID:18708352]" /note="Homeodomain-containing transcriptional repressor; regulates expression of PTR2, which encodes a major peptide transporter; imported peptides activate ubiquitin-dependent proteolysis, resulting in degradation of Cup9p and de-repression of PTR2 transcription; CUP9 has a paralog, TOS8, that arose from the whole genome duplication; protein abundance increases in response to DNA replication stress" /codon_start=1 /product="Cup9p" /protein_id="NP_015148.1" /db_xref="GeneID:855926" /db_xref="SGD:S000006098" /translation="
MNYNCEIQNRNSKNVDNQVSLPPIQVLFNSIEKRSMPELAFSNIEYSHGNLRSSTEEQNYPAPVLLPQHHSIAYPAINSGGTSTTATPTASTVETSKTSSSAMDTQSQYGSSKKSKSASDDAKPCYKSAPIYEIINKEKDAGAQYNRPFSDFVESKSRRKQNSGRRSNLPKETVQILNTWLLNHLNNPYPTQQEKRELLIKTGLTKIQLSNWFINVRRRKIFSDYYTLVNSIPNDNANNTPVERVQNVSAYHNTLSATNNTMYDATSTCSTDYELSKRFAHAPVTRRKKLIDRLEELKKLSNPDMN"
misc_feature order(493..495,502..504,631..633,640..645,655..657) /gene="CUP9" /locus_tag="YPL177C" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 541..657 /gene="CUP9" /locus_tag="YPL177C" /note="Homeobox KN domain; Region: Homeobox_KN; pfam05920" /db_xref="CDD:428673" ORIGIN
atgaattataactgcgaaatacaaaacaggaacagtaagaatgttgacaatcaagtcagtctaccccctatccaagttctatttaactccatagaaaaacggagtatgcccgagttggcattttcgaacatagaatactcgcatgggaaccttcggtctagtaccgaggaacaaaactatcctgcgcctgtgttacttccacagcatcattcgattgcgtatcccgcaattaattctggcggtactagtactactgctactcctactgcttctacagttgaaacgtccaagacgagtagcagtgctatggatacacaatctcaatatggcagttcaaagaagtcaaaatcggcgtccgatgatgcaaagccctgctacaaatccgccccaatatatgaaataatcaataaggaaaaggatgcgggggcacaatacaacaggccattttcggattttgtagaatctaaatcaaggaggaagcaaaattcgggcaggaggtctaacctgccaaaggaaacagtgcagatactgaatacttggttgctgaaccacctgaataacccctacccaactcaacaagaaaagagggagttgttaatcaaaactgggctaaccaagattcaactttctaattggttcataaatgtgagaagacgcaaaatatttagtgattactataccctggtaaactcaattcctaatgacaacgcgaataataccccagtggaacgagttcaaaacgtctcagcatatcataacacattatctgccacaaataatactatgtacgatgctacgtcaacctgctccacggattatgaattatccaagagatttgctcatgcccccgttacacgccgtaaaaaactaattgataggctggaagaattgaaaaagctatccaaccctgatatgaattga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]