GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-19 10:46:26, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001183991             921 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C Cup9p (CUP9), partial mRNA.
ACCESSION   NM_001183991
VERSION     NM_001183991.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 921)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 921)
  AUTHORS   Bussey,H., Storms,R.K., Ahmed,A., Albermann,K., Allen,E.,
            Ansorge,W., Araujo,R., Aparicio,A., Barrell,B., Badcock,K.,
            Benes,V., Botstein,D., Bowman,S., Bruckner,M., Carpenter,J.,
            Cherry,J.M., Chung,E., Churcher,C., Coster,F., Davis,K.,
            Davis,R.W., Dietrich,F.S., Delius,H., DiPaolo,T., Hani,J. et al.
  TITLE     The nucleotide sequence of Saccharomyces cerevisiae chromosome XVI
  JOURNAL   Nature 387 (6632 SUPPL), 103-105 (1997)
   PUBMED   9169875
REFERENCE   3  (bases 1 to 921)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   4  (bases 1 to 921)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 921)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (16-JAN-2015) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 921)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   7  (bases 1 to 921)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (14-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001148).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..921
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="XVI"
     gene            <1..>921
                     /gene="CUP9"
                     /locus_tag="YPL177C"
                     /db_xref="GeneID:855926"
     CDS             1..921
                     /gene="CUP9"
                     /locus_tag="YPL177C"
                     /experiment="EXISTENCE:curator inference:GO:0005634
                     nucleus [PMID:9427760]"
                     /experiment="EXISTENCE:direct assay:GO:0000978 RNA
                     polymerase II cis-regulatory region sequence-specific DNA
                     binding [PMID:9427760]"
                     /experiment="EXISTENCE:direct assay:GO:0043565
                     sequence-specific DNA binding [PMID:19158363]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0000122
                     negative regulation of transcription by RNA polymerase II
                     [PMID:17005992|PMID:10850718|PMID:9427760|PMID:18708352]"
                     /experiment="EXISTENCE:mutant phenotype:GO:2000877
                     negative regulation of oligopeptide transport
                     [PMID:17005992]"
                     /experiment="EXISTENCE:mutant phenotype:GO:2000879
                     negative regulation of dipeptide transport
                     [PMID:10850718|PMID:9427760|PMID:17005992|PMID:18708352]"
                     /experiment="EXISTENCE:physical interaction:GO:0061629 RNA
                     polymerase II-specific DNA-binding transcription factor
                     binding [PMID:18708352]"
                     /note="Homeodomain-containing transcriptional repressor;
                     regulates expression of PTR2, which encodes a major
                     peptide transporter; imported peptides activate
                     ubiquitin-dependent proteolysis, resulting in degradation
                     of Cup9p and de-repression of PTR2 transcription; CUP9 has
                     a paralog, TOS8, that arose from the whole genome
                     duplication; protein abundance increases in response to
                     DNA replication stress"
                     /codon_start=1
                     /product="Cup9p"
                     /protein_id="NP_015148.1"
                     /db_xref="GeneID:855926"
                     /db_xref="SGD:S000006098"
                     /translation="
MNYNCEIQNRNSKNVDNQVSLPPIQVLFNSIEKRSMPELAFSNIEYSHGNLRSSTEEQNYPAPVLLPQHHSIAYPAINSGGTSTTATPTASTVETSKTSSSAMDTQSQYGSSKKSKSASDDAKPCYKSAPIYEIINKEKDAGAQYNRPFSDFVESKSRRKQNSGRRSNLPKETVQILNTWLLNHLNNPYPTQQEKRELLIKTGLTKIQLSNWFINVRRRKIFSDYYTLVNSIPNDNANNTPVERVQNVSAYHNTLSATNNTMYDATSTCSTDYELSKRFAHAPVTRRKKLIDRLEELKKLSNPDMN"
     misc_feature    order(493..495,502..504,631..633,640..645,655..657)
                     /gene="CUP9"
                     /locus_tag="YPL177C"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    541..657
                     /gene="CUP9"
                     /locus_tag="YPL177C"
                     /note="Homeobox KN domain; Region: Homeobox_KN; pfam05920"
                     /db_xref="CDD:428673"
ORIGIN      
atgaattataactgcgaaatacaaaacaggaacagtaagaatgttgacaatcaagtcagtctaccccctatccaagttctatttaactccatagaaaaacggagtatgcccgagttggcattttcgaacatagaatactcgcatgggaaccttcggtctagtaccgaggaacaaaactatcctgcgcctgtgttacttccacagcatcattcgattgcgtatcccgcaattaattctggcggtactagtactactgctactcctactgcttctacagttgaaacgtccaagacgagtagcagtgctatggatacacaatctcaatatggcagttcaaagaagtcaaaatcggcgtccgatgatgcaaagccctgctacaaatccgccccaatatatgaaataatcaataaggaaaaggatgcgggggcacaatacaacaggccattttcggattttgtagaatctaaatcaaggaggaagcaaaattcgggcaggaggtctaacctgccaaaggaaacagtgcagatactgaatacttggttgctgaaccacctgaataacccctacccaactcaacaagaaaagagggagttgttaatcaaaactgggctaaccaagattcaactttctaattggttcataaatgtgagaagacgcaaaatatttagtgattactataccctggtaaactcaattcctaatgacaacgcgaataataccccagtggaacgagttcaaaacgtctcagcatatcataacacattatctgccacaaataatactatgtacgatgctacgtcaacctgctccacggattatgaattatccaagagatttgctcatgcccccgttacacgccgtaaaaaactaattgataggctggaagaattgaaaaagctatccaaccctgatatgaattga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]