LOCUS       NM_001182617             642 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C kinetochore-associated Ndc80 complex
            subunit SPC24 (SPC24), partial mRNA.
ACCESSION   NM_001182617
VERSION     NM_001182617.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 642)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 642)
  AUTHORS   Bowman,S., Churcher,C., Badcock,K., Brown,D., Chillingworth,T.,
            Connor,R., Dedman,K., Devlin,K., Gentles,S., Hamlin,N., Hunt,S.,
            Jagels,K., Lye,G., Moule,S., Odell,C., Pearson,D., Rajandream,M.,
            Rice,P., Skelton,J., Walsh,S., Whitehead,S. and Barrell,B.
  TITLE     The nucleotide sequence of Saccharomyces cerevisiae chromosome XIII
  JOURNAL   Nature 387 (6632 SUPPL), 90-93 (1997)
   PUBMED   9169872
REFERENCE   3  (bases 1 to 642)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   4  (bases 1 to 642)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 642)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 642)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   7  (bases 1 to 642)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (14-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001145).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..642
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="XIII"
     gene            <1..>642
                     /gene="SPC24"
                     /locus_tag="YMR117C"
                     /db_xref="GeneID:855144"
     CDS             1..642
                     /gene="SPC24"
                     /locus_tag="YMR117C"
                     /experiment="EXISTENCE:direct assay:GO:0000776 kinetochore
                     [PMID:11511347]"
                     /experiment="EXISTENCE:direct assay:GO:0031262 Ndc80
                     complex [PMID:11266451|PMID:11179222]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0000776
                     kinetochore [PMID:11179222]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0007059
                     chromosome segregation [PMID:11266451]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0098653
                     centromere clustering [PMID:11179222]"
                     /note="Component of the kinetochore-associated Ndc80
                     complex; involved in chromosome segregation, spindle
                     checkpoint activity, and kinetochore clustering;
                     evolutionarily conserved; other members include Ndc80p,
                     Nuf2p, Spc24p, and Spc25p"
                     /codon_start=1
                     /product="kinetochore-associated Ndc80 complex subunit
                     SPC24"
                     /protein_id="NP_013835.1"
                     /db_xref="GeneID:855144"
                     /db_xref="SGD:S000004723"
                     /translation="

MSQKDNLLDNPVEFLKEVRESFDIQQDVDAMKRIRHDLDVIKEESEARISKEHSKVSESNKKLNAERINVAKLEGDLEYTNEESNEFGSKDELVKLLKDLDGLERNIVSLRSELDEKMKLYLKDSEIISTPNGSKIKAKVIEPELEEQSAVTPEANENILKLKLYRSLGVILDLENDQVLINRKNDGNIDILPLDNNLSDFYKTKYIWERLGK"

     misc_feature    271..630
                     /gene="SPC24"
                     /locus_tag="YMR117C"
                     /note="Spc24 subunit of Ndc80; Region: Spc24; pfam08286"
                     /db_xref="CDD:429899"
ORIGIN      

atgtcacaaaaggataacctactcgacaatccggttgaatttttaaaagaggtcagagaaagttttgatattcagcaagatgttgatgccatgaaaagaatccgacacgatcttgatgttataaaagaggaaagcgaagcaagaattagtaaagagcattcaaaggtttctgagtcgaacaagaaattgaatgcggaaagaataaatgttgctaaattggagggagacttagaatatactaacgaagagagcaatgagtttggtagtaaagacgaactagttaaacttctgaaagatttggacggattggaacgtaatattgtgtcacttcgaagtgaattggacgaaaagatgaaattgtacctcaaagatagtgaaataatatccacaccgaacggttccaaaataaaagcaaaagtaattgaacctgagctggaagaacaaagtgcggtcaccccggaagcaaacgaaaatattctaaaattgaagctatacagatctttaggagttattttggatttagaaaatgatcaagtccttattaacagaaaaaatgatgggaatattgatattttacccttggacaataacctcagcgatttctataagaccaaatacatctgggaaagattaggaaagtga

//