2025-04-19 09:58:20, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001182305 1701 bp mRNA linear PLN 17-DEC-2024 DEFINITION Saccharomyces cerevisiae S288C ESCRT-II subunit protein VPS36 (VPS36), partial mRNA. ACCESSION NM_001182305 VERSION NM_001182305.3 DBLINK BioProject: PRJNA128 KEYWORDS RefSeq. SOURCE Saccharomyces cerevisiae S288C ORGANISM Saccharomyces cerevisiae S288C Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces. REFERENCE 1 (bases 1 to 1701) AUTHORS Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M., Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S., Weng,S. and Cherry,J.M. TITLE New data and collaborations at the Saccharomyces Genome Database: updated reference genome, alleles, and the Alliance of Genome Resources JOURNAL Genetics 220 (4) (2022) PUBMED 34897464 REFERENCE 2 (bases 1 to 1701) AUTHORS Johnston,M., Hillier,L., Riles,L., Albermann,K., Andre,B., Ansorge,W., Benes,V., Bruckner,M., Delius,H., Dubois,E., Dusterhoft,A., Entian,K.D., Floeth,M., Goffeau,A., Hebling,U., Heumann,K., Heuss-Neitzel,D., Hilbert,H., Hilger,F., Kleine,K., Kotter,P., Louis,E.J., Messenguy,F., Mewes,H.W., Hoheisel,J.D. et al. TITLE The nucleotide sequence of Saccharomyces cerevisiae chromosome XII JOURNAL Nature 387 (6632 SUPPL), 87-90 (1997) PUBMED 9169871 REFERENCE 3 (bases 1 to 1701) AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B., Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M., Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and Oliver,S.G. TITLE Life with 6000 genes JOURNAL Science 274 (5287), 546 (1996) PUBMED 8849441 REFERENCE 4 (bases 1 to 1701) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (17-DEC-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 5 (bases 1 to 1701) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (16-JAN-2015) Department of Genetics, Stanford University, Stanford, CA, USA REMARK Protein update by submitter REFERENCE 6 (bases 1 to 1701) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (06-FEB-2013) Department of Genetics, Stanford University, Stanford, CA, USA REMARK Protein update by submitter REFERENCE 7 (bases 1 to 1701) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (04-MAY-2012) Department of Genetics, Stanford University, Stanford, CA, USA REMARK Protein update by submitter REFERENCE 8 (bases 1 to 1701) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (31-MAR-2011) Department of Genetics, Stanford University, Stanford, CA, USA REMARK Sequence update by submitter REFERENCE 9 (bases 1 to 1701) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (14-DEC-2009) Department of Genetics, Stanford University, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by SGD. This record is derived from an annotated genomic sequence (NC_001144). On Jul 30, 2012 this sequence version replaced NM_001182305.2. ##Genome-Annotation-Data-START## Annotation Provider :: SGD Annotation Status :: Full Annotation Annotation Version :: R64-4-1 URL :: http://www.yeastgenome.org/ ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1701 /organism="Saccharomyces cerevisiae S288C" /mol_type="mRNA" /strain="S288C" /db_xref="taxon:559292" /chromosome="XII" gene <1..>1701 /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /db_xref="GeneID:851135" CDS 1..1701 /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /experiment="EXISTENCE:direct assay:GO:0000814 ESCRT II complex [PMID:12194858]" /experiment="EXISTENCE:direct assay:GO:0043130 ubiquitin binding [PMID:19380877|PMID:15029239]" /experiment="EXISTENCE:mutant phenotype:GO:0000122 negative regulation of transcription by RNA polymerase II [PMID:11278625]" /experiment="EXISTENCE:mutant phenotype:GO:0006623 protein targeting to vacuole [PMID:12194858]" /experiment="EXISTENCE:mutant phenotype:GO:0016236 macroautophagy [PMID:17428789|PMID:19793921]" /experiment="EXISTENCE:mutant phenotype:GO:0032258 cytoplasm to vacuole targeting by the Cvt pathway [PMID:19793921]" /experiment="EXISTENCE:mutant phenotype:GO:0045053 protein retention in Golgi apparatus [PMID:8649377]" /experiment="EXISTENCE:mutant phenotype:GO:1904669 ATP export [PMID:26585826]" /note="Component of ESCRT-II complex; contains GLUE (GRAM Like Ubiquitin binding in EAP45) domain which is involved in interactions with ESCRT-I and ubiquitin-dependent sorting of proteins into endosome; plays role in lager yeast flocculation under brewing conditions; plays role in formation of mutant huntingtin (Htt) aggregates in yeast" /codon_start=1 /product="ESCRT-II subunit protein VPS36" /protein_id="NP_013521.3" /db_xref="GeneID:851135" /db_xref="SGD:S000004409" /translation="
MEYWHYVETTSSGQPLLREGEKDIFIDQSVGLYHGKSKILQRQRGRIFLTSQRIIYIDDAKPTQNSLGLELDDLAYVNYSSGFLTRSPRLILFFKDPSSKDELGKSAETASADVVSTWVCPICMVSNETQGEFTKDTLPTPICINCGVPADYELTKSSINCSNAIDPNANPQNQFGVNSENICPACTFANHPQIGNCEICGHRLPNASKVRSKLNRLNFHDSRVHIELEKNSLARNKSSHSALSSSSSTGSSTEFVQLSFRKSDGVLFSQATERALENILTEKNKHIFNQNVVSVNGVDMRKGASSHEYNNEVPFIETKLSRIGISSLEKSRENQLLNNDILFNNALTDLNKLMSLATSIERLYKNSNITMKTKTLNLQDESTVNEPKTRRPLLILDREKFLNKELFLDEIAREIYEFTLSEFKDLNSDTNYMIITLVDLYAMYNKSMRIGTGLISPMEMREACERFEHLGLNELKLVKVNKRILCVTSEKFDVVKEKLVDLIGDNPGSDLLRLTQILSSNNSKSNWTLGILMEVLQNCVDEGDLLIDKQLSGIYYYKNSYWPSHI"
misc_feature 10..366 /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /note="Pleckstrin homology-like domain or GLUE (GRAM-like ubiquitin-binding in Eap45) domain of Vps36; Region: PH-GRAM-like_Vps36; cd13227" /db_xref="CDD:275409" misc_feature order(112..114,256..258,265..267) /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /note="phosphoinositide binding site [chemical binding]; other site" /db_xref="CDD:275409" misc_feature 325..492 /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /note="Vacuolar protein sorting 36 NZF-N zinc-finger domain; Region: Vps36-NZF-N; pfam16988" /db_xref="CDD:407195" misc_feature 352..438 /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /note="RanBP2-type Zn finger [structural motif]; Region: RanBP2-type Zn finger" /db_xref="CDD:275376" misc_feature 535..609 /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /note="Zinc finger domain; Region: ZnF_RBZ; smart00547" /db_xref="CDD:197784" misc_feature 541..600 /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /note="RanBP2-type Zn finger [structural motif]; Region: RanBP2-type Zn finger" /db_xref="CDD:275376" misc_feature 967..1644 /gene="VPS36" /locus_tag="YLR417W" /gene_synonym="GRD12; VAC3; VPL11" /note="EAP30/Vps36 family; Region: EAP30; pfam04157" /db_xref="CDD:461201" ORIGIN
atggagtactggcattatgtggaaactacgtcatcgggccaacctcttcttcgagaaggtgaaaaagatatctttatcgatcagtccgtaggtctttaccatggcaaatctaagattctacagcgacagaggggcagaatctttttaacgtcacaaagaattatctacatcgacgatgcaaagcccactcagaactcgcttgggttggaattggacgatctagcgtatgtaaactattcatctggcttcttgaccagatcacctcgtctgatcctgtttttcaaggacccctccagtaaggatgaacttggtaaaagtgcggaaacagcaagtgccgacgttgtttcgacgtgggtctgccccatctgtatggtttcgaacgaaacgcagggggaattcactaaagacactctacctacacccatttgtatcaattgcggtgtgccagcggactatgagctcaccaagtcgtctataaattgttctaatgcaatcgacccgaacgccaacccacagaatcagttcggagtgaactctgagaacatttgccccgcctgtacttttgctaatcatcctcaaataggaaattgcgagatttgcggccacagattgcctaatgcatccaaagtacgatcaaagctgaacaggctaaactttcatgattctagggtccatattgagctagaaaaaaattcactggctagaaacaagagctcgcactcggcattatcgtcctcgtcctcgacaggatcatcgacagaattcgtgcaattgagtttccgcaaatctgatggcgtattgttttcacaagctacagagagggctttggagaatatactcactgaaaagaataagcatattttcaatcagaatgtggtttctgtaaatggtgtagacatgaggaaaggggctagttctcacgaatacaacaatgaggtgccatttattgagactaaattgagcagaattggcatatcaagcttggaaaaatctagagaaaaccagcttttgaacaatgacattctctttaacaatgcgttgaccgacctaaacaagctaatgtcgctggctaccagcatcgaaagactatacaaaaatagcaacataacgatgaaaaccaagacattgaacttacaggatgaatcaaccgtgaatgaaccgaaaacgagaagaccgctattgatacttgatagagagaagttcctaaataaagagctgttcttggatgagattgcgagagaaatttacgagttcacgttgtccgagtttaaagatttgaacagtgataccaactatatgatcataactctggtagatctatatgcaatgtacaacaaatctatgcgtataggtacaggcctgatatctcccatggaaatgagagaagcatgcgaaagattcgagcatttaggtctaaatgaattgaagttagtgaaagttaacaaaagaatattatgtgtaacgagcgaaaaattcgacgttgtaaaagaaaagctagtagatctgatcggtgataatcctggttctgatctcctaagattgacacagattttgagttccaataattcaaaatcaaactggacgctaggtatccttatggaggtattacaaaattgtgtcgatgaaggcgatttactgatagacaagcaactgagtgggatttactactataaaaactcttattggccctcgcatatataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]