GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-19 09:58:20, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001181781             678 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C ribosomal 40S subunit protein S5
            (RPS5), partial mRNA.
ACCESSION   NM_001181781
VERSION     NM_001181781.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 678)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 678)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   3  (bases 1 to 678)
  AUTHORS   Galibert,F., Alexandraki,D., Baur,A., Boles,E., Chalwatzis,N.,
            Chuat,J.C., Coster,F., Cziepluch,C., De Haan,M., Domdey,H.,
            Durand,P., Entian,K.D., Gatius,M., Goffeau,A., Grivell,L.A.,
            Hennemann,A., Herbert,C.J., Heumann,K., Hilger,F., Hollenberg,C.P.,
            Huang,M.E., Jacq,C., Jauniaux,J.C., Katsoulou,C.,
            Karpfinger-Hartl,L. et al.
  TITLE     Complete nucleotide sequence of Saccharomyces cerevisiae chromosome
            X
  JOURNAL   EMBO J. 15 (9), 2031-2049 (1996)
   PUBMED   8641269
REFERENCE   4  (bases 1 to 678)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 678)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 678)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (12-APR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   7  (bases 1 to 678)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (14-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001142).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..678
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="X"
     gene            <1..>678
                     /gene="RPS5"
                     /locus_tag="YJR123W"
                     /db_xref="GeneID:853587"
     CDS             1..678
                     /gene="RPS5"
                     /locus_tag="YJR123W"
                     /experiment="EXISTENCE:direct assay:GO:0003735 structural
                     constituent of ribosome [PMID:6814480]"
                     /experiment="EXISTENCE:direct assay:GO:0022627 cytosolic
                     small ribosomal subunit [PMID:6814480|PMID:385049]"
                     /experiment="EXISTENCE:direct assay:GO:0030686 90S
                     preribosome [PMID:12150911]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0000054
                     ribosomal subunit export from nucleus [PMID:16246728]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0030490
                     maturation of SSU-rRNA [PMID:20419091]"
                     /note="Protein component of the small (40S) ribosomal
                     subunit; least basic of non-acidic ribosomal proteins;
                     phosphorylated in vivo; essential for viability;
                     homologous to mammalian ribosomal protein S5 and bacterial
                     S7"
                     /codon_start=1
                     /product="ribosomal 40S subunit protein S5"
                     /protein_id="NP_012657.1"
                     /db_xref="GeneID:853587"
                     /db_xref="SGD:S000003884"
                     /translation="
MSDTEAPVEVQEDFEVVEEFTPVVLATPIPEEVQQAQTEIKLFNKWSFEEVEVKDASLVDYVQVRQPIFVAHTAGRYANKRFRKAQCPIIERLTNSLMMNGRNNGKKLKAVRIIKHTLDIINVLTDQNPIQVVVDAITNTGPREDTTRVGGGGAARRQAVDVSPLRRVNQAIALLTIGAREAAFRNIKTIAETLAEELINAAKGSSTSYAIKKKDELERVAKSNR"
     misc_feature    121..675
                     /gene="RPS5"
                     /locus_tag="YJR123W"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(121..123,202..210,214..225,322..324,334..336)
                     /gene="RPS5"
                     /locus_tag="YJR123W"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(214..216,220..222,232..243,250..252,274..276,
                     283..285,289..303,313..327,334..336,454..462,466..468,
                     496..498,517..519,538..540,547..549,565..570)
                     /gene="RPS5"
                     /locus_tag="YJR123W"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(346..348,355..360,367..369,565..567,571..576)
                     /gene="RPS5"
                     /locus_tag="YJR123W"
                     /note="S25 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(451..453,460..462,466..468,673..675)
                     /gene="RPS5"
                     /locus_tag="YJR123W"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
ORIGIN      
atgtctgacaccgaagctccagttgaagttcaagaagatttcgaagttgttgaagaattcaccccagtcgtcttggctactccaattccagaagaagtccaacaagctcaaaccgagattaagttgttcaacaaatggtcttttgaagaagttgaagttaaggatgcttctttggttgactacgttcaagttagacaaccaatctttgttgctcacaccgctggtcgttacgccaacaagagattcagaaaggctcaatgtccaatcattgaaagattgaccaactccttgatgatgaacggtagaaacaacggtaagaaattaaaggctgttagaatcatcaagcacactttggacatcatcaatgtcttgactgaccaaaacccaatccaagttgttgttgacgctatcaccaacactggtccaagagaagacaccaccagagtcggtggtggtggtgctgctagacgtcaagctgtcgatgtttctccattgagaagagttaaccaagctattgctttgttgaccattggtgccagagaagctgctttcagaaacatcaagaccattgctgaaactttggccgaagaattgatcaatgctgctaagggttcctctacttcttacgctatcaagaagaaggatgaattggaacgtgttgccaagtctaaccgttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]