2025-04-19 09:57:19, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001180913 1218 bp mRNA linear PLN 17-DEC-2024 DEFINITION Saccharomyces cerevisiae S288C proteasome regulatory particle base subunit RPT6 (RPT6), partial mRNA. ACCESSION NM_001180913 VERSION NM_001180913.1 DBLINK BioProject: PRJNA128 KEYWORDS RefSeq. SOURCE Saccharomyces cerevisiae S288C ORGANISM Saccharomyces cerevisiae S288C Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces. REFERENCE 1 (bases 1 to 1218) AUTHORS Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M., Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S., Weng,S. and Cherry,J.M. TITLE New data and collaborations at the Saccharomyces Genome Database: updated reference genome, alleles, and the Alliance of Genome Resources JOURNAL Genetics 220 (4) (2022) PUBMED 34897464 REFERENCE 2 (bases 1 to 1218) AUTHORS Tettelin,H., Agostoni Carbone,M.L., Albermann,K., Albers,M., Arroyo,J., Backes,U., Barreiros,T., Bertani,I., Bjourson,A.J., Bruckner,M., Bruschi,C.V., Carignani,G., Castagnoli,L., Cerdan,E., Clemente,M.L., Coblenz,A., Coglievina,M., Coissac,E., Defoor,E., Del Bino,S., Delius,H., Delneri,D., de Wergifosse,P., Dujon,B., Kleine,K. et al. TITLE The nucleotide sequence of Saccharomyces cerevisiae chromosome VII JOURNAL Nature 387 (6632 SUPPL), 81-84 (1997) PUBMED 9169869 REFERENCE 3 (bases 1 to 1218) AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B., Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M., Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and Oliver,S.G. TITLE Life with 6000 genes JOURNAL Science 274 (5287), 546 (1996) PUBMED 8849441 REFERENCE 4 (bases 1 to 1218) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (17-DEC-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 5 (bases 1 to 1218) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (16-JAN-2015) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Protein update by submitter REFERENCE 6 (bases 1 to 1218) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (04-MAY-2012) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Protein update by submitter REFERENCE 7 (bases 1 to 1218) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (31-MAR-2011) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Sequence update by submitter REFERENCE 8 (bases 1 to 1218) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (11-DEC-2009) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA COMMENT REVIEWED REFSEQ: This record has been curated by SGD. This record is derived from an annotated genomic sequence (NC_001139). ##Genome-Annotation-Data-START## Annotation Provider :: SGD Annotation Status :: Full Annotation Annotation Version :: R64-4-1 URL :: http://www.yeastgenome.org/ ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1218 /organism="Saccharomyces cerevisiae S288C" /mol_type="mRNA" /strain="S288C" /db_xref="taxon:559292" /chromosome="VII" gene <1..>1218 /gene="RPT6" /locus_tag="YGL048C" /gene_synonym="CIM3; CRL3; SCB68; SUG1" /db_xref="GeneID:852834" CDS 1..1218 /gene="RPT6" /locus_tag="YGL048C" /gene_synonym="CIM3; CRL3; SCB68; SUG1" /experiment="EXISTENCE:direct assay:GO:0005634 nucleus [PMID:10419517]" /experiment="EXISTENCE:direct assay:GO:0008540 proteasome regulatory particle, base subcomplex [PMID:9741626|PMID:11742986]" /experiment="EXISTENCE:direct assay:GO:0019904 protein domain specific binding [PMID:7870180]" /experiment="EXISTENCE:direct assay:GO:0034515 proteasome storage granule [PMID:18504300]" /experiment="EXISTENCE:genetic interaction:GO:0006289 nucleotide-excision repair [PMID:11410533]" /experiment="EXISTENCE:genetic interaction:GO:0045899 positive regulation of RNA polymerase II transcription preinitiation complex assembly [PMID:16269334]" /experiment="EXISTENCE:mutant phenotype:GO:0006338 chromatin remodeling [PMID:20855529]" /experiment="EXISTENCE:mutant phenotype:GO:0032968 positive regulation of transcription elongation by RNA polymerase II [PMID:11389845]" /experiment="EXISTENCE:mutant phenotype:GO:0045899 positive regulation of RNA polymerase II transcription preinitiation complex assembly [PMID:19843524]" /experiment="EXISTENCE:mutant phenotype:GO:0070651 nonfunctional rRNA decay [PMID:22505030]" /experiment="EXISTENCE:mutant phenotype:GO:0070682 proteasome regulatory particle assembly [PMID:19412160]" /experiment="EXISTENCE:physical interaction:GO:0031625 ubiquitin protein ligase binding [PMID:12447385|PMID:10688918]" /experiment="EXISTENCE:physical interaction:GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process [PMID:10688918]" /note="ATPase of the 19S regulatory particle of the 26S proteasome; one of six ATPases of the regulatory particle; involved in the degradation of ubiquitinated substrates; bound by ubiquitin-protein ligases Ubr1p and Ufd4p; localized mainly to the nucleus throughout the cell cycle; protein abundance increases in response to DNA replication stress" /codon_start=1 /product="proteasome regulatory particle base subunit RPT6" /protein_id="NP_011467.1" /db_xref="GeneID:852834" /db_xref="SGD:S000003016" /translation="
MTAAVTSSNIVLETHESGIKPYFEQKIQETELKIRSKTENVRRLEAQRNALNDKVRFIKDELRLLQEPGSYVGEVIKIVSDKKVLVKVQPEGKYIVDVAKDINVKDLKASQRVCLRSDSYMLHKVLENKADPLVSLMMVEKVPDSTYDMVGGLTKQIKEIKEVIELPVKHPELFESLGIAQPKGVILYGPPGTGKTLLARAVAHHTDCKFIRVSGAELVQKYIGEGSRMVRELFVMAREHAPSIIFMDEIDSIGSTRVEGSGGGDSEVQRTMLELLNQLDGFETSKNIKIIMATNRLDILDPALLRPGRIDRKIEFPPPSVAARAEILRIHSRKMNLTRGINLRKVAEKMNGCSGADVKGVCTEAGMYALRERRIHVTQEDFELAVGKVMNKNQETAISVAKLFK"
misc_feature 34..1197 /gene="RPT6" /locus_tag="YGL048C" /gene_synonym="CIM3; CRL3; SCB68; SUG1" /note="proteasome-activating nucleotidase; Provisional; Region: PRK03992" /db_xref="CDD:179699" ORIGIN
atgacagctgctgtaacatcctccaatatagtattagaaacccacgaaagtggtatcaaaccatattttgaacagaagatccaagaaacagaattaaagatccgctccaaaacagaaaatgttcgcagactggaagctcaaaggaatgcattgaatgacaaagtacgttttatcaaggacgaactgcgtctattacaggaacctggatcttatgtgggtgaagttataaagatcgtgtctgacaaaaaagttctcgttaaagtgcaacctgagggaaaatacatcgtggatgttgcaaaagatataaacgtgaaggacttaaaggcatctcaaagagtttgtctaaggagtgactcttatatgttgcataaagttcttgagaataaggctgacccactagtttcgttgatgatggtggaaaaagttcctgattccacatacgatatggttggtggtttgacaaagcaaataaaggagattaaagaagttattgaattgcccgtaaaacatcctgaactttttgaaagtttgggtattgcgcaaccaaagggtgtcatcttatatggcccccctggtacagggaaaaccttattggcaagagctgtcgcacatcacactgattgtaaattcatcagggtcagtggtgcggaactggtacaaaagtatatcggcgaaggttcccgtatggtccgtgagctgtttgtgatggctagagaacatgctccctcaattatctttatggatgaaatcgattccattggctctactcgtgtagaaggttctggtggtggtgattcagaagttcaaagaacaatgttagaactactaaaccaattggacgggtttgaaacttctaaaaatatcaagatcataatggccacgaatagactagatattctagatccagcacttttgagacccggtagaatagataggaagattgaatttccacctccaagtgtcgcagctagagctgaaattttaagaatccattccagaaaaatgaatctaactcgtggtatcaacttgagaaaggttgctgaaaagatgaacggttgttctggtgccgatgtcaaaggtgtctgtacagaagctggtatgtatgctttaagagaaagaagaatacacgttactcaagaagacttcgaactcgctgtgggtaaggttatgaacaagaaccaagaaacggccatttctgtcgccaagctgttcaagtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]