GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-19 09:57:19, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001180913            1218 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C proteasome regulatory particle base
            subunit RPT6 (RPT6), partial mRNA.
ACCESSION   NM_001180913
VERSION     NM_001180913.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 1218)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 1218)
  AUTHORS   Tettelin,H., Agostoni Carbone,M.L., Albermann,K., Albers,M.,
            Arroyo,J., Backes,U., Barreiros,T., Bertani,I., Bjourson,A.J.,
            Bruckner,M., Bruschi,C.V., Carignani,G., Castagnoli,L., Cerdan,E.,
            Clemente,M.L., Coblenz,A., Coglievina,M., Coissac,E., Defoor,E.,
            Del Bino,S., Delius,H., Delneri,D., de Wergifosse,P., Dujon,B.,
            Kleine,K. et al.
  TITLE     The nucleotide sequence of Saccharomyces cerevisiae chromosome VII
  JOURNAL   Nature 387 (6632 SUPPL), 81-84 (1997)
   PUBMED   9169869
REFERENCE   3  (bases 1 to 1218)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   4  (bases 1 to 1218)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 1218)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (16-JAN-2015) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 1218)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   7  (bases 1 to 1218)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   8  (bases 1 to 1218)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (11-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001139).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1218
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="VII"
     gene            <1..>1218
                     /gene="RPT6"
                     /locus_tag="YGL048C"
                     /gene_synonym="CIM3; CRL3; SCB68; SUG1"
                     /db_xref="GeneID:852834"
     CDS             1..1218
                     /gene="RPT6"
                     /locus_tag="YGL048C"
                     /gene_synonym="CIM3; CRL3; SCB68; SUG1"
                     /experiment="EXISTENCE:direct assay:GO:0005634 nucleus
                     [PMID:10419517]"
                     /experiment="EXISTENCE:direct assay:GO:0008540 proteasome
                     regulatory particle, base subcomplex
                     [PMID:9741626|PMID:11742986]"
                     /experiment="EXISTENCE:direct assay:GO:0019904 protein
                     domain specific binding [PMID:7870180]"
                     /experiment="EXISTENCE:direct assay:GO:0034515 proteasome
                     storage granule [PMID:18504300]"
                     /experiment="EXISTENCE:genetic interaction:GO:0006289
                     nucleotide-excision repair [PMID:11410533]"
                     /experiment="EXISTENCE:genetic interaction:GO:0045899
                     positive regulation of RNA polymerase II transcription
                     preinitiation complex assembly [PMID:16269334]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0006338
                     chromatin remodeling [PMID:20855529]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0032968
                     positive regulation of transcription elongation by RNA
                     polymerase II [PMID:11389845]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0045899
                     positive regulation of RNA polymerase II transcription
                     preinitiation complex assembly [PMID:19843524]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0070651
                     nonfunctional rRNA decay [PMID:22505030]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0070682
                     proteasome regulatory particle assembly [PMID:19412160]"
                     /experiment="EXISTENCE:physical interaction:GO:0031625
                     ubiquitin protein ligase binding
                     [PMID:12447385|PMID:10688918]"
                     /experiment="EXISTENCE:physical interaction:GO:0043161
                     proteasome-mediated ubiquitin-dependent protein catabolic
                     process [PMID:10688918]"
                     /note="ATPase of the 19S regulatory particle of the 26S
                     proteasome; one of six ATPases of the regulatory particle;
                     involved in the degradation of ubiquitinated substrates;
                     bound by ubiquitin-protein ligases Ubr1p and Ufd4p;
                     localized mainly to the nucleus throughout the cell cycle;
                     protein abundance increases in response to DNA replication
                     stress"
                     /codon_start=1
                     /product="proteasome regulatory particle base subunit
                     RPT6"
                     /protein_id="NP_011467.1"
                     /db_xref="GeneID:852834"
                     /db_xref="SGD:S000003016"
                     /translation="
MTAAVTSSNIVLETHESGIKPYFEQKIQETELKIRSKTENVRRLEAQRNALNDKVRFIKDELRLLQEPGSYVGEVIKIVSDKKVLVKVQPEGKYIVDVAKDINVKDLKASQRVCLRSDSYMLHKVLENKADPLVSLMMVEKVPDSTYDMVGGLTKQIKEIKEVIELPVKHPELFESLGIAQPKGVILYGPPGTGKTLLARAVAHHTDCKFIRVSGAELVQKYIGEGSRMVRELFVMAREHAPSIIFMDEIDSIGSTRVEGSGGGDSEVQRTMLELLNQLDGFETSKNIKIIMATNRLDILDPALLRPGRIDRKIEFPPPSVAARAEILRIHSRKMNLTRGINLRKVAEKMNGCSGADVKGVCTEAGMYALRERRIHVTQEDFELAVGKVMNKNQETAISVAKLFK"
     misc_feature    34..1197
                     /gene="RPT6"
                     /locus_tag="YGL048C"
                     /gene_synonym="CIM3; CRL3; SCB68; SUG1"
                     /note="proteasome-activating nucleotidase; Provisional;
                     Region: PRK03992"
                     /db_xref="CDD:179699"
ORIGIN      
atgacagctgctgtaacatcctccaatatagtattagaaacccacgaaagtggtatcaaaccatattttgaacagaagatccaagaaacagaattaaagatccgctccaaaacagaaaatgttcgcagactggaagctcaaaggaatgcattgaatgacaaagtacgttttatcaaggacgaactgcgtctattacaggaacctggatcttatgtgggtgaagttataaagatcgtgtctgacaaaaaagttctcgttaaagtgcaacctgagggaaaatacatcgtggatgttgcaaaagatataaacgtgaaggacttaaaggcatctcaaagagtttgtctaaggagtgactcttatatgttgcataaagttcttgagaataaggctgacccactagtttcgttgatgatggtggaaaaagttcctgattccacatacgatatggttggtggtttgacaaagcaaataaaggagattaaagaagttattgaattgcccgtaaaacatcctgaactttttgaaagtttgggtattgcgcaaccaaagggtgtcatcttatatggcccccctggtacagggaaaaccttattggcaagagctgtcgcacatcacactgattgtaaattcatcagggtcagtggtgcggaactggtacaaaagtatatcggcgaaggttcccgtatggtccgtgagctgtttgtgatggctagagaacatgctccctcaattatctttatggatgaaatcgattccattggctctactcgtgtagaaggttctggtggtggtgattcagaagttcaaagaacaatgttagaactactaaaccaattggacgggtttgaaacttctaaaaatatcaagatcataatggccacgaatagactagatattctagatccagcacttttgagacccggtagaatagataggaagattgaatttccacctccaagtgtcgcagctagagctgaaattttaagaatccattccagaaaaatgaatctaactcgtggtatcaacttgagaaaggttgctgaaaagatgaacggttgttctggtgccgatgtcaaaggtgtctgtacagaagctggtatgtatgctttaagagaaagaagaatacacgttactcaagaagacttcgaactcgctgtgggtaaggttatgaacaagaaccaagaaacggccatttctgtcgccaagctgttcaagtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]