2025-04-19 09:58:18, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001180014 372 bp mRNA linear PLN 17-DEC-2024 DEFINITION Saccharomyces cerevisiae S288C alpha-ketoglutarate dehydrogenase subunit KGD4 (KGD4), partial mRNA. ACCESSION NM_001180014 VERSION NM_001180014.3 DBLINK BioProject: PRJNA128 KEYWORDS RefSeq. SOURCE Saccharomyces cerevisiae S288C ORGANISM Saccharomyces cerevisiae S288C Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces. REFERENCE 1 (bases 1 to 372) AUTHORS Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M., Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S., Weng,S. and Cherry,J.M. TITLE New data and collaborations at the Saccharomyces Genome Database: updated reference genome, alleles, and the Alliance of Genome Resources JOURNAL Genetics 220 (4) (2022) PUBMED 34897464 REFERENCE 2 (bases 1 to 372) AUTHORS Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B., Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M., Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and Oliver,S.G. TITLE Life with 6000 genes JOURNAL Science 274 (5287), 546 (1996) PUBMED 8849441 REFERENCE 3 (bases 1 to 372) AUTHORS Murakami,Y., Naitou,M., Hagiwara,H., Shibata,T., Ozawa,M., Sasanuma,S., Sasanuma,M., Tsuchiya,Y., Soeda,E., Yokoyama,K. et al. TITLE Analysis of the nucleotide sequence of chromosome VI from Saccharomyces cerevisiae JOURNAL Nat. Genet. 10 (3), 261-268 (1995) PUBMED 7670463 REFERENCE 4 (bases 1 to 372) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (17-DEC-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 5 (bases 1 to 372) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (16-JAN-2015) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Protein update by submitter REFERENCE 6 (bases 1 to 372) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (04-MAY-2012) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Protein update by submitter REFERENCE 7 (bases 1 to 372) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (31-MAR-2011) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA REMARK Sequence update by submitter REFERENCE 8 (bases 1 to 372) CONSRTM Saccharomyces Genome Database TITLE Direct Submission JOURNAL Submitted (11-DEC-2009) Department of Genetics, Stanford University, Stanford, CA 94305-5120, USA COMMENT REVIEWED REFSEQ: This record has been curated by SGD. This record is derived from an annotated genomic sequence (NC_001138). On Jul 30, 2012 this sequence version replaced NM_001180014.2. ##Genome-Annotation-Data-START## Annotation Provider :: SGD Annotation Status :: Full Annotation Annotation Version :: R64-4-1 URL :: http://www.yeastgenome.org/ ##Genome-Annotation-Data-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..372 /organism="Saccharomyces cerevisiae S288C" /mol_type="mRNA" /strain="S288C" /db_xref="taxon:559292" /chromosome="VI" gene <1..>372 /gene="KGD4" /locus_tag="YFR049W" /gene_synonym="YMR31" /db_xref="GeneID:850610" CDS 1..372 /gene="KGD4" /locus_tag="YFR049W" /gene_synonym="YMR31" /experiment="EXISTENCE:direct assay:GO:0003735 structural constituent of ribosome [PMID:2693936]" /experiment="EXISTENCE:direct assay:GO:0004591 oxoglutarate dehydrogenase (succinyl-transferring) activity [PMID:25165143]" /experiment="EXISTENCE:direct assay:GO:0005739 mitochondrion [PMID:24769239|PMID:16823961]" /experiment="EXISTENCE:direct assay:GO:0005761 mitochondrial ribosome [PMID:2693936]" /experiment="EXISTENCE:direct assay:GO:0045252 oxoglutarate dehydrogenase complex [PMID:25165143]" /experiment="EXISTENCE:mutant phenotype:GO:0004591 oxoglutarate dehydrogenase (succinyl-transferring) activity [PMID:25165143]" /experiment="EXISTENCE:mutant phenotype:GO:0006099 tricarboxylic acid cycle [PMID:25165143]" /experiment="EXISTENCE:mutant phenotype:GO:0006103 2-oxoglutarate metabolic process [PMID:25165143]" /note="Subunit of the mitochondrial alpha-ketoglutarate dehydrogenase; recruits E3 subunit (Lpd1p) to the E1-E2 (Kgd1p, Kgd2p) core; exists in two forms derived from a single mRNA translated from two alternative start sites; evolutionarily conserved role in the organization of mitochondrial alpha-KGDH complexes; homolog of human KGD4" /codon_start=1 /product="alpha-ketoglutarate dehydrogenase subunit KGD4" /protein_id="NP_116707.3" /db_xref="GeneID:850610" /db_xref="SGD:S000001945" /translation="
MIATPIRLAKSAYEPMIKFVGTRHPLVKHATEVVVHPCATNGMLPGSKECIPVSKFMENYKPFRVVPIKHSANAGLSSSKTSVFVNRPLQKDELASIFELPARFRYKPINEHELESINSGGAW"
misc_feature 46..366 /gene="KGD4" /locus_tag="YFR049W" /gene_synonym="YMR31" /note="Ribosomal protein S36, mitochondrial; Region: S36_mt; pfam10937" /db_xref="CDD:402493" ORIGIN
atgattgctacacctataagattagcaaagagtgcatatgagccgatgataaaattcgtcggtacaaggcatcccttagtgaagcatgcaactgaggtcgttgttcatccttgcgctaccaacggaatgttacctggcagcaaagagtgtattccagtgagtaaattcatggaaaattataaaccattccgtgtagtgccaataaagcatagcgctaatgctggtctcagctcgtcaaagacctctgtattcgttaacaggccattgcaaaaagatgagcttgcttccattttcgagctacctgctaggtttcggtacaaacctattaacgagcatgaattggagagcataaatagcggtggtgcatggtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]