LOCUS       NM_001178497            1035 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C D-arabinose 1-dehydrogenase
            (NAD(P)(+)) ARA1 (ARA1), partial mRNA.
ACCESSION   NM_001178497
VERSION     NM_001178497.3
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 1035)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 1035)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   3  (bases 1 to 1035)
  AUTHORS   Feldmann,H., Aigle,M., Aljinovic,G., Andre,B., Baclet,M.C.,
            Barthe,C., Baur,A., Becam,A.M., Biteau,N., Boles,E. et al.
  TITLE     Complete DNA sequence of yeast chromosome II
  JOURNAL   EMBO J. 13 (24), 5795-5809 (1994)
   PUBMED   7813418
REFERENCE   4  (bases 1 to 1035)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 1035)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 1035)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   7  (bases 1 to 1035)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (11-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001134).
            
            On Jul 30, 2012 this sequence version replaced NM_001178497.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1035
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="II"
     gene            <1..>1035
                     /gene="ARA1"
                     /locus_tag="YBR149W"
                     /db_xref="GeneID:852446"
     CDS             1..1035
                     /gene="ARA1"
                     /locus_tag="YBR149W"
                     /EC_number="1.1.1.117"
                     /experiment="EXISTENCE:direct assay:GO:0005829 cytosol
                     [PMID:9920381]"
                     /experiment="EXISTENCE:direct assay:GO:0005975
                     carbohydrate metabolic process [PMID:9920381]"
                     /experiment="EXISTENCE:direct assay:GO:0045149 acetoin
                     metabolic process [PMID:33845171]"
                     /experiment="EXISTENCE:direct assay:GO:0045290 D-arabinose
                     1-dehydrogenase [NAD(P)+] activity [PMID:9920381]"
                     /experiment="EXISTENCE:direct assay:GO:0052588 diacetyl
                     reductase ((S)-acetoin forming) (NAD+) activity
                     [PMID:33845171]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0005975
                     carbohydrate metabolic process [PMID:9920381]"
                     /note="NADP+ dependent arabinose dehydrogenase; involved
                     in carbohydrate metabolism; purified as homodimer;
                     naturally occurs with a N-terminus degradation product"
                     /codon_start=1
                     /product="D-arabinose 1-dehydrogenase (NAD(P)(+)) ARA1"
                     /protein_id="NP_009707.3"
                     /db_xref="GeneID:852446"
                     /db_xref="SGD:S000000353"
                     /translation="

MSSSVASTENIVENMLHPKTTEIYFSLNNGVRIPALGLGTANPHEKLAETKQAVKAAIKAGYRHIDTAWAYETEPFVGEAIKELLEDGSIKREDLFITTKVWPVLWDEVDRSLNESLKALGLEYVDLLLQHWPLCFEKIKDPKGISGLVKTPVDDSGKTMYAADGDYLETYKQLEKIYLDPNDHRVRAIGVSNFSIEYLERLIKECRVKPTVNQVETHPHLPQMELRKFCFMHDILLTAYSPLGSHGAPNLKIPLVKKLAEKYNVTGNDLLISYHIRQGTIVIPRSLNPVRISSSIEFASLTKDELQELNDFGEKYPVRFIDEPFAAILPEFTGNGPNLDNLKY"

     misc_feature    64..963
                     /gene="ARA1"
                     /locus_tag="YBR149W"
                     /note="Saccharomyces cerevisiae D-arabinose dehydrogenase
                     [NAD(P)+] heavy chain (Ara1p) and similar proteins;
                     Region: AKR_AKR3C1; cd19119"
                     /db_xref="CDD:381345"
     misc_feature    order(115..123,196..198,208..213,298..300,391..396,
                     574..579,640..642,718..738,766..768,802..804,847..864,
                     871..873,880..885)
                     /gene="ARA1"
                     /locus_tag="YBR149W"
                     /note="active site"
                     /db_xref="CDD:381345"
     misc_feature    order(196..198,211..213,298..300,391..393)
                     /gene="ARA1"
                     /locus_tag="YBR149W"
                     /note="catalytic tetrad [active]"
                     /db_xref="CDD:381345"
ORIGIN      

atgtcttcttcagtagcctcaaccgaaaacatagtcgaaaatatgttgcatccaaagactacagaaatatacttttcactcaacaatggtgttcgtatcccagcactgggtttggggacagcaaatcctcacgaaaagttagctgaaacaaaacaagccgtaaaagctgcaatcaaagctggatacaggcacattgatactgcttgggcctacgagacagagccattcgtaggtgaagccatcaaggagttattagaagatggatctatcaaaagggaggatcttttcataaccacaaaagtgtggccggttctatgggacgaagtggacagatcattgaatgaatctttgaaagctttaggcttggaatacgtcgacttgctcttgcaacattggccgctatgttttgaaaagattaaggaccctaaggggatcagcggactggtgaagactccggttgatgattctggaaaaacaatgtatgctgccgacggtgactatttagaaacttacaagcaattggaaaaaatttaccttgatcctaacgatcatcgtgtgagagccattggtgtctcaaatttttccattgagtatttggaacgtctcattaaggaatgcagagttaagccaacggtgaaccaagtggaaactcaccctcacttaccacaaatggaactaagaaagttctgctttatgcacgacattctgttaacagcatactcaccattaggttcccatggcgcaccaaacttgaaaatcccactagtgaaaaagcttgccgaaaagtacaatgtcacaggaaatgacttgctaatttcttaccatattagacaaggcactatcgtaattccgagatccttgaatccagttaggatttcctcgagtattgaattcgcatctttgacaaaggatgaattacaagagttgaacgacttcggtgaaaaatacccagtgagattcatcgatgagccatttgcagccatccttccagagtttactggtaacggaccaaacttggacaatttaaagtattaa

//