2024-11-23 05:31:50, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS XM_039087250 25229 bp mRNA linear ROD 22-FEB-2024 DEFINITION PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X24, mRNA. ACCESSION XM_039087250 VERSION XM_039087250.1 DBLINK BioProject: PRJNA1074393 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_086028) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_036323735.1-RS_2024_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/09/2024 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..25229 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /bio_material="RGD 61498" /db_xref="taxon:10116" /chromosome="10" /sex="male" /tissue_type="kidney, spleen, liver" /geo_loc_name="USA: Wisconsin, Milwaukee" /lat_lon="43.05 N 88.04 W" /collected_by="Rebecca Schilling, Melinda Dwinell" gene 1..25229 /gene="Obscn" /note="obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 84 long SRA reads, 32 Proteins" /db_xref="GeneID:338458" /db_xref="RGD:631335" CDS 186..25175 /gene="Obscn" /codon_start=1 /product="obscurin isoform X24" /protein_id="XP_038943178.1" /db_xref="GeneID:338458" /db_xref="RGD:631335" /translation="
MDHSFSGAPRFLTRPKAFVVSVGKDATLSCQIVGNPTPHVSWEKDRQPVEAGARFRLAQDGDVYRLTILDLALGDSGQYVCRARNAIGEAFAAVGLRVDSEGTCAEQAPHFLLRPTSIRVREGADATFRCRVGGSPQPAVSWSKDGRRLGAPDAPHVRVEDRGEASALRIRSARPRDGGTYEVRAENPLGSASAAAALVVDSDAEAAGPPGTSVATLLAHLQQRREAMRAEGVPPSPPGAGTRTCTVTEGKHARLSCFVTGEPKPETVWKKDGQLVNEGRRHVVYEDEQENFVLKILFCKQSDRGLYTCTASNLVGQTYSSVLVVVREPAVPFKKRLQDLEVREKESATFQCEVAQPATEAAWFKEETRLWASAKYDIEEEGTERRLTVRNVSADDDAVYICETTEGSRTVAELSVKGNLTRKLPRKTAVRTGDTAIFWVELAVPEGPVQWLRNQEEMVAGGRIAITAEGTCHTLTIFQCTLEDMGEVAFVAGGCRTTTQFCVSAPRRPPLYPPADPVVKAKTESSVTLSWSPPPHGDRPVTIDGYVVEKRKLGAYAWSRCHEAEWLATTEFTIAGVAEEGDFQFRVSAINHFGHSPYLEFPGTMHLVPTLAVKTPLKAVEAMEGGEVTFSVDLTVASSGEWFLDGKALKESSTYVIRCDRTRHMLTIREVPASLHGAQLKFVANGIETSIQMVVRGALGLPSNKLPAVAAREVLAQLHEEAQLLAELSDQAAAVTWLKDGRELSLGPKYEMQVSAGKQALLVRDVAQDDAGLYECVSRGSRITYQLLVQEANLMFAKKQQARSEVKAEVGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRMEASGCSRRLVVQQVGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKGQQSHSKVKAEAGANATLSCEVAQAQTEVTWFKDGKKLSSSSKVCVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFCLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVSWFKDGKKLSSSSKVRMEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGANATLSCEVAEAQTEVSWFKDGKKLSSSSKLRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVMWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKLVFAKEQQACSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVCVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKLVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVPEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKLVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVSWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQACSEVKAEAGASATLSCEVAQAQTEVIWFKDGKKLSSSSKVRVEASGCSRRLVVQQVGKADAGEYSCEAGGQKVSFRLDVPDTKLMFAKEQQACSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPEPESQTPQRPSRREPLVIKEHETIVLSATIAAPSVAAVTWLKDGVEIRRSKRHETTSVGDTHTLTVRGAQVLDSAIYSCRVGKEGQDFPVQVEEVATKFSKPLEPVEGELGGTVTLVCELSPEQAEVVWRCGSTQLRAGKRFQMTAEGSRRTLTVSGLREDDAEEYVCESRDDRTSARLTVKVPRVVKFTSGLSAMAAEEGQEATFQCVVSPSDAAVMWYKDGTQLQPSEKFVMVQSGASRSLTILGLTLEDAGHVTVEAEGASSSAALRVREAPVLFKKKLEPQTVEERTPVTLEVELTRPWPEVKWTRNAAVLVPSENVEIHAEGARHRLVLRSVGFADRGFFGCETPDDKTQAKLNVEMRQVRLVRGLQEVEAKEQGTASMDVELSHADVEGSWTRDGLRLQPGPKCHLAVQGPVHILTLSALQPQDSGLVAFRAEGVHTSARLIVTELPVSFTRLLQDVVATQKEKVTLECELSRPVDVRWLKDGVELRAGKAIGIVAQGTCRSLVIYRCETGDQGVYVCDALDAQTSASLRVQGRSVQIMKPLEDVEVMEKEGATFSCEVSHDEVPGIWFREATKLRPSDNVRIRQEGRTYTLIFRRVLAEDAGEIKFVAENAESRAHLRVKELPVTLLRPLRDKIAMEKHRGVLECQVSRASAQVRWFKGKVELQPGPKYEVVSDGLYRKLVINDVQPEDEDTYTCDAGDVKTSAQFFVEEQSITIVRGLKDMTVMEPAPAWFECETSIPSVRPPKWLLGKTVLQAGGNVGLEQDGTVHRLTLHKTCSTMTGPVHFTIGKSRSTAQLVVSDIPVVLTRPLEPKAGRELQSVVLSCDFRPAPKAVQWYKEDTPLSPSEKFKMVLEGQMAELRILRLTPADAGVYRCQAGSAQSSAEVTVEAREVTVIQPLQDVEAMEEGRVCFSCELSHKDEDIEWSLNGTPLYSDSFHEISHEGCLHTLVLKSVRQADTGTVCATSPKVSVSARLVVKAKPVVFLKALDDVSAEERGTLTLQCEVSDPEARVVWRKDGVELGPSDKYDFLHKAGVRSLTVHDMSHEDAGLYTCQVGSKETQSRVSVHDLHVGITKRLKTVEVLEGESCSFECVLSHESPSDPAVWTVGGKIVRSSDHFQAVRQGRKYTLTVKDAALSDAGEVVFSVLGLTSKASLIIREKPVDITKPLEDQHTTPGEDVMLSCELSRAGSSVRWLKDGKAIRKSQKYDLLIEGTQAVLVVRKASLKDSGEYTCETEASRSTARLCVEEKTNRFTEELADLQVEEKGRAVFTCKTEQPASIVTWRKGLLELRASGKHVPSQEGLTLTLTINALERTDSDTYTCDIGQARTQARLLVHGQKVRVIEDLEDTAVQEGSSAKFCCRISPADYGPVHWFLDKTPLHSNELNEITVQSGGYHVLTLRQLTLKDSGTVYFEAGDQRTSAALRVTEKPSIFSRPLTDVTVTEGEDLTLVCETTTPDSSVRWTKDGKTLRPSARCQLNREGCQAQLVITGTTLQDGGRYKCEVGGASSSSIVRVHARPVRFRESLKDMEVPEGKAATLRCVLSSVAAPVEWRHGDDVLKSSNKYSLRQEGAVLELVIRDLKPQDSGQYSCSFGDQTTSATLTVKTSSAQFIGKLRNKEATEGTMATLRCELTKEAPVEWKKGTETLRNGDKYSLKQDGAVCELQICNLLVADAGEYLCVCGQEKTSATLTVKAVPVHFIRRLRNKEATEGDTVTLQCELSKAAPVEWRKGTETLRDGDRYSLKQDGAVCELQIRSLAVADAGEYLCMCGQEKTSATLTIRALPARFIEDLRSQEVPESSTVTMRCELSKKAPVVWRKGSETLKNGARYSLRQDGAVCELEIRDLTVEDAGEYSCTCGKERTSATLSIMAPQVVFQKLLENLQAEEGSTASLRCELSVPNTAVVWSKGGLELQADTCRETRQQGCVAELLLRDVRREDAGEYSCTCGSQTTSATLMVTAAPVRFLQELQAQDVDEGTTARLRCELSREAASVEWRKGSLQLFPCAKYQMVQEGTTAELLVHGVEQEDAGEYTCDAGHMQSIARLSVRAPKPKFKTGLQSKEQEAGGTARLCCQLSEAESGTPVQWLKEGVELHVSSKYEMRCQGAMCELLIHKLEAKDTGEYACVVGGQKTLASLRVKEPEVTIVQGLVDMEVQADEDVEFTCKVSQAGATDVQWHLQGLPLQSNEVTEVAVLGDGCTHVLQLKGVTLDDAGTVSFHVGSHSSSAQLIVRVPEVTVLEPLKDVQLSEGQDAHFQCRLSRASGQEARWALGGVPLQCNEMNDITVEQGTLYSLTLHKVTLEDAGTITLQVGSCSSEAQLKVTEAALCLVRGLQNVDVFAGEVATFSCEVSRAGGPEARWWLDGTLLQNSPESAMTVREGTVHSLTLSGLGVADSGTITFRTGPLVSTAKLLVKDPTVEVVSAMQDLVVEEGGSAELLCQYSRPVQAMWKMNEREVCADGHRVIIEQDWTVARLTLRPALPCDSGIYSCEAAGTRVVALLQVQAKNTVVRGLENVDALEGGEALFECQLSQPEVAAHTWLLDDEPVHTSANVEVVYFENGLRHLLLLKNLKPQDSCRVTFLAGDVVTSAFLTVRGWRLEVLEPPQDASVKAGTQVCFTCILSEALPVGEATWYINGAAIQPDDADWIVTADGSHHALTLSNAQPQHAGEVTFAARDAVASARLSVLALPGPPEDAEVVGRSDHSVTLSWVAPVSDGGGGLCGYRVEMKEASTGQWQLCHELVPGPECVVDGLVSGKTYRFRVAAVGPAGAGEPVHLPQMVKIAEPMEPKPAPAPAPALAPTPAPIPTPAPAPAPAPTPAPTPTPAPAPAPAPAPATRRAVVGEDVCLELEVAADAGEVVWHKGTERIHPSGHFEVLSQGQRQMLVIKGFRTEDQGEYRCGPIQGLPSSGASTFNVVVTSGSEDEVPAQPSLPPEAAQEGDLHLLWEALARKRRMSREPTLDSISELPEEDSRVQHLRQEAEEAAPDLSEGYSTADELARTGEADLSHTSSDDESRAGTPSLITYLKKAGGPGISPLASKHEAQVATSVKPQKQQERVVPTCPLPGDLNAADLKDPSLDKAAVKIQAAFKGYKVRKEMKQQGGPVFSRTFGDTEAQVGDALRLECVVSTKADVRACWLKDGVELTDGRHYHIDQLKDGTCSLLVTGLGPTDSGRYTCQVSTKFGSVSHSACVMVSGTESEAESSSGGELDDAFRRAARRLHRLFRTKSPAELSEEELFLSADEGPMEPEEPADWQTYREDENFVCIRFESLAEAHRAVTCFRDMFATMGIGVEISLGEQGPRGVEMRIGKVAPTVIPAVPLAKTPGLQTSDAAPVFLTELQNQDVQDGYPMSFDCVVTGQPVPSVRWFKDGKLLEEDDHYMINEDQQGGHQLIITAVVPADMGVYRCLAENSMGVSSTKAELRVELTSTDYDTAADATETSSYFSAQGYLSSREQEGTESDEGQLPQVLEELKDLQVAPGTRLAKFQLKVKGYPAPKLYWFKDGQPLTTSDHIRMTDKKTLHTLEIVSITREDSGQYAAYISNAVGAAYSSARLLVRGPSEPEEKPQPDVHERLVPPRILEKFTPKKVKRGSSITFSVKVEGHPAPSVHWLKEEAEKGVLWIGPDTPGYTMASSSKQHSLVLLDVGRQHQGTYTCIATNAAGQALCSASLHISGLAKEEEQERVKEALISSFLQGTSQAVSAQMSESASFADLVGQRKGESLVAEEAHSHLSLSEVGTEEFLQKLTSQITEMVSAKISQAKLQVPGGDSDEESKTPSASPRHGRSRPSSSVQESSSESEDGDSRGEIFDIYVVTADYLPLGAEQDAIILREGQYVEVLDSAHPLRWLVRTKPTKSSPSRQGWVSPAYLDKRLKLSPEWGPTEAPEFPGEAVSEDEYRTRLSSVIQELLSSEQAFVGELQFLESHHIKHLDRSPRVPAAVASQKTVIFRNVQDISHFHSSFLKELQSCGTDDDVAMCFIKNQEAFEKYLEFLVGRVQAESVVVSTPVQEFYKKYAEEMLSAKDPTQPPPPPLQHYLEQPVERVQKYQALLKELIRNKARNRQNCALLEQAYAVVSALPQRAENKLHVSLMENYPGTLEALGEPIRQGHFIVWEGAPGARMPWKGHNRHVFLFRNHLVICKPRRDSRTDTFSYVFRNMMKLNSIDLNDQVEGDDRAFEVWHEREDSVRKYLLQARTVIIKNSWVKEICGIQQRLAQPVWRPPEFEEELADCTAELGETVKLACRVTGTPKPIVSWYKDGKPVEVDPHHILIEDPDGSCTLILDNLTGIDSGQYMCFAASAAGNASTLGKILVQVPPRFVNKVRATPFVEGEDAQITCTVEGAPYPQIRWYKDGALLTLGNRYRMVNEPRSGMLVLVIQAASKEDLGHYECELVNRLGSTRCGGELYMQSPALRAWDQHHREQLVAAVEDASMEDSAHPTQEGADQQAASVLWRLLGSEALSPSPGGFPNTRQSEPPTSEEAAPQIPGTTSGTPGKLPEASRPGTYKGLEQGMTTTSGSQERNVPIRVEGTAWPGGGTGQLLLDVHSQVIMETTQRTYVCQAPDTGVTRAPSMQVTIEDLQVQVGDMAQFDAVIEGNPPPTVTWYKDSNQLVNGTRLRQQQGGTTYSLVLMDVTPHDAGVYTCVAQNAGGQVLCKAELLVYGGDKSDAEKQAYRRKLHSFYEVQEEIGRGVFGFVKRVQHKGNKMSCAAKFIPLRSKTRAQAYQERDILATLSHPLVTGLLDQFETQKTLILILELCSSEELLDRLFKKAVVTEAEVKVYIQQLVEGLHYLHSHDILHLDIKPPNILMVHPAREDIKICDFGFAQKITPSEPQYSKYGSPEFVSPEIIEQSPVSEGSDIWAMGVISYLSLTCSSPFAGESDRATLLNVLEGRVSWSSPMAAHLSEDAKDFIKATLQKTPRARPSASQCLAHPWFLKSMPAEEAHFINTKQLKFLLARSRWQRSLMSYKSILVMRSIPELLQGPPDSPSLGVARHLRGEASGSSSSSSSSDNELAPFARAKSLPPSPVTHSPLLHPRGFLRPSASLPEETEASMSTADAAMPAPPQSAGPPASPGCVPRHSVISSLFYQQAGEGAERGSKALGAKRHPARRRHLLKGGYIARALPGLREPLMEFSVLEEEAANEEQASLMTKTPSFETALRLPSSNVREVPGRSRSLDNPPGTASPSPEAYKEQYLSPPSSGLTHETTAKGMGHKEGFLQESVPFSPTSGDLRPVKQEGSSQDSCRGKPASSCHSELGSGPQEGCGSPSSQLCGSLPPQSSKKELSKPCGPLFSEQPQAAPFPAQASPLLGSQKEPQDSYLPEKPCPVPSSSPGSASQVDASLDTEGLSEAGDTCDFTPPLQRPQEQATTRKFSLESRGGYAGVAGYGTFAFGGDAGGMLGQGPLWARMAWAVSQSSEEQDEAATESPQPLDSSGPIAEASGVPLRTSPSLTPWEEVEQVSLVQIRDLSGDAEAADTISLDISEVDPAYLNLSDLYDIKYLPFEFMIFRRVPKPVEQPESPGSETEEGQGLAEFLEEAVWPWPGELGLRAGLEITEEPQEPGDLEALLGEAAVGRKRKWSPSRGLFQFPGRCLSGEEPVELGLRQRVKASMAHISRILKGKPEGPEKEGPPRKKAGLASFRLSGLKGRDQAPSFLRELSDEAVVLGQSVTLACQVLAQPTAQATWSKDGALLESSGHLLISSTLKNFQLLTILVVTEEDLGTYTCCVSNPLGTAVTTGVLRKAERPSSSPRPEVGELYTDAVLLVWKPVESYGPVTYIVQCCIEGGSWTTLASDISDCCYLTGKLPRGGMYTFRTACVSKAGMGPYSSPSEQVLLGGPNHLASEEESSRGRPAQLLPSTKTFAFQTQIRRGRFSVVRQCREKASGRALAAKIVPYQPEDKTTVLREYEALKRLHHPHLAQLHAAYLSPRHLVLILELCSGPELLPSLAERDSYSESDVKDYLWQMLSATQYLHAQHILHLDLRSENMMVTEYNLLKVIDLGNAQSLSQEKVPPPENFKDYLETMAPELLEGQGAVPQTDIWAIGVTAFIMLSGEYPVSSEGTRDLQKGLRKGLIQLSRCYAGLSGGAVAFLQSSLCARPWGRPCASTCLQCGWLTEEGPTGSRPTPVTFPTARLRAFVREREKRRALLYKKHNLAQVR"
misc_feature 210..479 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 261..275 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 300..314 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 366..380 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 417..434 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 510..785 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 561..575 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 600..614 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 681..695 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 723..740 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 921..1163 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 942..956 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 981..995 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1059..1073 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1101..1118 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1140..1151 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1182..1433 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1227..1241 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1263..1277 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1338..1352 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1380..1397 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1452..1661 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 1491..1505 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1527..1541 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1602..1616 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1644..1661 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1671..1682 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1722..1985 /gene="Obscn" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(1968..1973,1977..1982) /gene="Obscn" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 2028..>2198 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2313..2552 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2349..2363 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2385..2399 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2460..2474 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2502..2519 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2529..2540 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2583..2828 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2625..2639 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2661..2675 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2736..2750 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2778..2795 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2805..2816 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2859..3104 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 2901..2915 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2937..2951 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3012..3026 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3054..3071 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3081..3092 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3135..3380 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 3177..3191 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3213..3227 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3288..3302 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3330..3347 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3357..3368 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3411..3656 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 3453..3467 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3489..3503 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3564..3578 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3606..3623 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3633..3644 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3687..3932 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 3729..3743 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3765..3779 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3840..3854 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3882..3899 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3909..3920 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3963..4208 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 4005..4019 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4041..4055 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4116..4130 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4158..4175 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4185..4196 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4239..4484 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 4281..4295 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4317..4331 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4392..4406 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4434..4451 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4461..4472 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4515..4760 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 4557..4571 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4593..4607 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4668..4682 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4710..4727 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4737..4748 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4791..5036 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 4833..4847 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4869..4883 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4944..4958 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4986..5003 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5013..5024 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5067..5312 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5109..5123 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5145..5159 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5220..5234 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5262..5279 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5289..5300 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5343..5588 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5385..5399 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5421..5435 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5496..5510 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5538..5555 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5565..5576 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5619..5864 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5661..5675 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5697..5711 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5772..5786 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5814..5831 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5841..5852 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5895..6140 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 5937..5951 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5973..5987 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6048..6062 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6090..6107 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6117..6128 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6171..6416 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 6213..6227 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6249..6263 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6324..6338 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6366..6383 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6393..6404 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6447..6692 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 6489..6503 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6525..6539 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6600..6614 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6642..6659 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6669..6680 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6744..6944 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 6771..6785 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6810..6824 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6885..6899 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6927..6944 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7002..7244 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 7041..7055 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7077..7091 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7152..7166 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7194..7211 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7221..7232 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7263..7514 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 7311..7325 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7347..7361 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7422..7436 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7464..7481 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7491..7502 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7533..7784 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 7578..7592 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7614..7628 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7689..7703 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7731..7748 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8064..8312 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 8112..8126 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8145..8159 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8220..8234 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8262..8279 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8289..8300 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 8328..8579 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 8376..8390 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8415..8426 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8487..8501 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8529..8546 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8601..8846 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 8646..8657 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8679..8693 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8754..8768 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8796..8813 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9132..9383 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9180..9194 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9219..9230 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9291..9305 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9333..9350 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9402..9650 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 9450..9461 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9483..9497 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9558..9572 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9627..9638 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9666..9917 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 9714..9728 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9750..9764 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9825..9839 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9867..9884 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9936..>10142 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 9981..9995 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10023..10037 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10098..10112 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10239..10457 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 10254..10268 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10290..10304 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10365..10379 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10407..10424 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10434..10445 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10473..10724 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 10521..10535 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10557..10571 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10632..10646 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10746..10997 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 10788..10802 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10827..10841 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10905..10919 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10974..10985 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11016..11264 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11061..11075 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11097..11111 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11172..11186 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11214..11231 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11241..11252 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11280..11531 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 11328..11342 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11367..11378 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11442..11453 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11508..11519 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11547..11795 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 11595..11609 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11628..11642 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11703..11717 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11745..11762 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11772..11783 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11811..12059 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 11859..11873 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11892..11906 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11967..11981 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12009..12026 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12036..12047 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12075..12323 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12123..12137 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12159..12170 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12231..12245 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12273..12290 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12300..12311 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12339..12590 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12387..12401 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12423..12437 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12498..12512 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12540..12557 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12567..12578 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12606..12857 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12654..12668 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12690..12704 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12765..12779 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12807..12824 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12834..12845 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12906..13130 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 12921..12935 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12963..12977 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13038..13052 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13080..13097 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13107..13118 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13149..13406 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 13194..13208 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13233..13247 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13308..13328 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13413..13679 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 13470..13484 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13509..13523 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13587..13601 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13656..13667 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13701..13916 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 13743..13757 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13782..13796 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13860..13874 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13986..14186 /gene="Obscn" /note="Immunoglobulin like; Region: IG_like; smart00410" /db_xref="CDD:214653" misc_feature 14235..14492 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 14508..14768 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 14556..14570 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14598..14612 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14676..14690 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14718..14735 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14745..14756 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14778..15035 /gene="Obscn" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(14778..14780,14973..14975,15018..15020) /gene="Obscn" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(15021..15026,15030..15035) /gene="Obscn" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 15225..15410 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 15246..15260 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15282..15296 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15357..15371 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16020..16292 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16071..16085 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16110..16124 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16188..16202 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16230..16247 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16269..16280 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16710..16982 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 16761..16775 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16800..16814 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16878..16892 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16920..16937 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16959..16970 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 17106..17378 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 17157..17174 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 17199..17213 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17274..17288 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 17316..17333 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 17355..17366 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 17439..17726 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 17490..17504 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 17529..17543 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17622..17636 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 17664..17681 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 17703..17714 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 18132..18320 /gene="Obscn" /note="Src homology 3 domain of Obscurin and similar proteins; Region: SH3_Obscurin_like; cd12025" /db_xref="CDD:212958" misc_feature order(18153..18155,18159..18161,18183..18188,18237..18245, 18294..18296,18300..18302,18306..18311) /gene="Obscn" /note="peptide ligand binding site [polypeptide binding]; other site" /db_xref="CDD:212958" misc_feature 18417..18947 /gene="Obscn" /note="Guanine nucleotide exchange factor for Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous (DH) domain. It appears that PH domains invariably occur C-terminal to RhoGEF/DH domains; Region: RhoGEF; cl02571" /db_xref="CDD:470622" misc_feature order(18426..18428,18438..18440,18804..18809,18816..18821, 18825..18830,18837..18842,18849..18854,18861..18863, 18939..18941) /gene="Obscn" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:238091" misc_feature 18972..19346 /gene="Obscn" /note="Obscurin pleckstrin homology (PH) domain; Region: PH_Obscurin; cd13239" /db_xref="CDD:270059" misc_feature 19368..19640 /gene="Obscn" /note="First immunoglobulin-like domains A168 within the A-band segment of human cardiac titin, and similar domains; a member of the I-set of IgSF domains; Region: IgI_1_Titin-A168_like; cd20971" /db_xref="CDD:409563" misc_feature 19383..19403 /gene="Obscn" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409563" misc_feature 19416..19442 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409563" misc_feature 19458..19475 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409563" misc_feature 19482..19490 /gene="Obscn" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409563" misc_feature 19506..19529 /gene="Obscn" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409563" misc_feature 19536..19556 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409563" misc_feature 19575..19601 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409563" misc_feature 19608..19640 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409563" misc_feature 19650..19919 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 19701..19715 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 19740..19754 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 19821..19835 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 19863..19880 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 19902..19913 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 20412..20681 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 20463..20477 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 20502..20516 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 20577..20591 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 20619..20636 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 20658..20669 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 20733..21503 /gene="Obscn" /note="The protein kinase superfamily is mainly composed of the catalytic domains of serine/threonine-specific and tyrosine-specific protein kinases. It also includes RIO kinases, which are atypical serine protein kinases, aminoglycoside phosphotransferases; Region: Protein Kinases, catalytic domain; cl21453" /db_xref="CDD:473864" misc_feature order(20760..20771,20778..20780,20784..20786,20823..20825, 20829..20831,20913..20915,20961..20972,21099..21101, 21111..21116,21120..21122,21156..21161) /gene="Obscn" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:271009" misc_feature 23652..23900 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 23703..23717 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 23742..23756 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 23817..23834 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 23862..23879 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 23904..23915 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 23934..24170 /gene="Obscn" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature 24270..25040 /gene="Obscn" /note="The protein kinase superfamily is mainly composed of the catalytic domains of serine/threonine-specific and tyrosine-specific protein kinases. It also includes RIO kinases, which are atypical serine protein kinases, aminoglycoside phosphotransferases; Region: Protein Kinases, catalytic domain; cl21453" /db_xref="CDD:473864" misc_feature order(24300..24311,24318..24320,24324..24326,24363..24365, 24369..24371,24453..24455,24501..24512,24639..24641, 24651..24656,24660..24662,24690..24695) /gene="Obscn" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:271012" polyA_site 25229 /gene="Obscn" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
gcctgtcctttcgtccctgtccagtctgaggaccggctggagtgtgggctgctgggtgggaaccacgtcgtcctgggccccaggaaggaggcagacccagcagccccccaactcaccatctgtgccccttgcctgggtgctgccccaacccctggtagacacagtcccccaaccctgctaacatcatggaccactccttcagcggagcaccccgcttcctgacgcggccaaaggcttttgtggtatctgttggcaaggatgccacgctgagctgccagatcgtgggcaaccccacgccacacgtgagctgggagaaggaccggcagccagtggaggcaggagcacgcttccgcctggcccaggacggggatgtgtaccgcctcaccatcctcgatctggctctaggtgacagcgggcagtacgtgtgtcgagcgaggaacgccataggggaggccttcgccgctgtaggtttgcgagtggactcggagggcacgtgtgccgagcaggcgccccactttctgctgcggcccacctccattcgtgtgcgcgagggcgcagacgccaccttccgatgtcgcgtcggcggctcaccgcaacctgctgtgagctggtccaaagatgggcggcgcctaggtgcaccagatgccccccacgtgcgcgtggaagatcgcggagaggcgagcgcgcttcgcatccggtcggcaaggcctcgcgatggtggcacctacgaagttcgagcagagaacccactgggctccgccagcgctgccgccgctctcgtggtggactcggatgccgaggctgccggaccacccggaacctccgttgccacgctcctggcgcacctgcagcagcggcgcgaggccatgcgcgcagagggcgtccctccttctccacctggtgctggcacgcgcacctgcacggtgaccgaaggcaaacacgcgcgcctcagctgctttgtgaccggcgagcccaagcccgagacagtgtggaagaaggacgggcagctggtgaacgagggccggagacacgtagtatatgaggatgagcaagagaacttcgtccttaagattcttttttgcaagcagtctgatcgcggcctctacacttgcacagcatccaacctcgtgggccagacctacagctcggtgctggtggtcgtgagagagcctgcggtgcccttcaagaagcggctgcaggacctggaggtgcgagagaaagagtctgccacattccagtgtgaggtggctcagccagccaccgaggcggcgtggttcaaggaggagacccggctatgggccagcgccaagtacgacatcgaggaggagggcaccgagcgccggctgactgtgcgcaacgtctcggcagacgacgacgcggtgtacatctgcgagaccacagagggcagccgcacggtggcagagctctcagttaaaggaaacttgaccagaaagctgcctcggaaaacagcagtgaggactggagacacagccatcttttgggtggagctggctgtccccgaaggccctgtccagtggctacggaaccaggaggagatggtggcagggggcaggattgccatcactgcagaaggcacttgccacacactgaccatcttccagtgcaccttggaggacatgggtgaggtggccttcgtggctggtggctgcagaacgactacccagttctgtgtatcagcacccaggaggccacccctgtaccctcctgctgaccctgttgtgaaggccaagacagagagttctgtgacccttagctggtccccaccaccccatggggaccgccctgtcactattgatggttatgtggtggagaagaggaagctgggtgcctatgcctggagcaggtgtcatgaagcagaatggctggccacaactgagtttactattgctggcgtggctgaggaaggggacttccagttccgagtgtcagccatcaatcactttggccacagtccttaccttgagtttccagggaccatgcacttggtccccacgctggctgtaaagacacctctgaaggcggtggaggccatggagggtggtgaggtcactttctccgtggacctcacggtggcgtcttcgggtgagtggttcctggacgggaaggccttgaaagagagcagtacatacgtgatccgttgtgaccgtacccggcacatgctcaccatcagagaggtgcctgccagcttgcacggggcacagctgaagtttgtggctaatggcattgaaaccagcatccaaatggtggtccgaggggctctggggctgcccagcaacaagcttcctgccgtggctgcccgggaggtgctggcccagctgcatgaggaggcacagctgctggctgagctgtcagaccaggctgcggctgtgacttggctaaaggatggtcgtgagctgtccctaggacccaagtatgagatgcaggtgtcggctgggaagcaagcactgctggtgcgggatgtggcacaggatgacgctgggctctatgagtgtgttagtcgtgggagccgcatcacctaccagctgttggtgcaagaggccaatttgatgtttgccaagaagcagcaggcacgcagcgaggtgaaggcagaggttggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcatggaggcctcgggctgctccaggaggctggtggtgcagcaggtgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggggcagcagtcacacagcaaggtgaaggcagaggcaggggccaatgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctccaaggtgtgtgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttctgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcaggagccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgtcatggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcatggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtcacagaacccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccaatgccacactgagctgcgaggtggccgaggcccagactgaggtgtcatggttcaaggacgggaagaagctgagctccagctccaagctgcgtgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagaacccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggatgtggcagaacccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcgggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggctcgcagcgaggtgaaggcagaggcgggggccagtgccacactgagctgcgaggtggcccaggcccagactgaagtgatgtggttcaaggacgggaagaagctgagctccagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaagctggtgtttgccaaggagcagcaggcatgcagtgaggtgaaggcagaggccggggccagcgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctctagctcgaaggtgtgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggacgtagcagagcccaagctggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaagcgggcaaggcagatgctggagagtacagctgtgaggccgggggacagaaggtctccttccgcctggatgtgccagagcccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctccaaggtgcgagtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggacgtcacagagcccaagctggtatttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggctggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcaggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgtcgtggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcatgcagcgaggtgaaggcagaggcaggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgatatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggtgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggatgtgccagacaccaaacttatgtttgccaaggagcagcaggcatgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgtgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtggcagaaccagagcctgagtcccaaactccacagaggcctagccgcagggagcctctggttatcaaggaacatgagaccattgtcctgagtgccacgatagctgcaccctctgtggctgctgtgacctggctcaaagacggcgtggagatccgccgcagcaagcggcatgagaccaccagtgtgggtgatactcataccctgactgtgagaggtgcacaggttctggacagtgccatctacagctgccgtgtcggcaaggaaggtcaggacttcccggtgcaggtagaagaggtggccaccaagttctccaaacccctggagcctgtggaaggggaattgggtggcactgtgacgctggtctgtgagctgagcccggaacaggctgaggttgtgtggcgctgtgggagcacacagctgcgggcgggcaagcgcttccagatgacagctgaggggtctaggcgcacactgaccgtgtctggccttcgagaggacgacgcagaggagtatgtgtgtgagagccgggatgaccgcaccagtgcacggctcactgtcaaagttccccgagtggtcaagtttacatccggattgagtgccatggcggcagaggagggccaagaggccacctttcagtgtgtcgtgtcccccagcgatgcagcagtcatgtggtacaaggacggcacgcagctgcagcctagcgagaagtttgttatggtgcagagtggggccagccgaagcttgactatcttgggcctgaccctggaggatgctgggcatgtcactgtggaggctgagggtgcttcatcatctgctgccctccgggtccgagaggcaccagtcctcttcaaaaagaagcttgagccacagacggtggaggagaggacccctgtgaccctggaagtagagctgactcgcccctggcccgaggtgaagtggacgcggaatgctgccgtcctggtacccagcgagaacgtggaaatccacgctgagggtgcccggcaccgtctggtgctgcgaagcgtgggcttcgctgaccgtggcttctttggctgtgagacaccagatgacaagactcaggccaagctcaacgtagaaatgcggcaggtccggctggttcgaggtttgcaggaggtggaggctaaggaacagggcacagcctcgatggatgtggaattgtcccatgctgacgtggaaggcagctggactcgagatggcctgcgacttcagccggggcccaaatgccacctggccgtacaaggccctgtccacatcctcacactctcagcgctgcagccacaggacagcgggttggtggccttcagggctgagggcgtgcacacgtctgcacggctcatagtcactgagttgcccgtgagcttcaccagactgctacaggatgtggtggccactcagaaggagaaggtgaccctggagtgtgagttgtcacggcccgtcgatgtgcgctggctgaaggatggtgtggagctgcgggcaggcaaggccataggcatagtggctcagggaacctgcaggagtctcgttatctaccggtgtgagactggggaccagggcgtctatgtatgtgatgctctggatgctcagacctctgcctctctgagggtgcagggacgcagtgttcagattatgaagcccctagaggatgtggaggtgatggagaaggagggtgccacattctcctgtgaggtgtcccatgatgaggttcctggcatatggttccgagaagccactaagctacggcccagtgacaatgtgcgcatccggcaggaagggaggacatatactctcatcttccggagggtactggcagaagatgcgggggagatcaagtttgtagctgaaaatgcagaatcaagggctcacctccgagtgaaagaactgcctgtgaccctcctgcgcccactacgggacaagattgccatggaaaaacaccgtggcgtgcttgagtgccaggtgtcccgggctagtgcccaggtgcggtggttcaagggcaaagtcgagctgcagcctgggcccaagtatgaggtggtcagcgacggcctttaccgcaaactggtcatcaatgatgtgcagcccgaggacgaagatacttacacctgtgatgctggcgatgtgaagaccagtgcccagttcttcgtggaagagcaatccatcactattgtgcgggggctgaaggacatgacagttatggagcctgcccctgcctggtttgaatgtgagacctccattccttctgtgaggccacccaagtggctccttggtaagactgtgctacaggcaggggggaacgtggggctggagcaagacggtactgtgcaccgactgacacttcacaagacctgctctaccatgaccgggcctgtgcacttcaccatcggcaagtcccgctccactgcccagcttgttgtctcagacattcctgtggtattgacaaggcctctggagcccaaagcagggcgcgagctgcagtcggtcgtcctgtcctgtgacttcaggccagcccccaaggctgtgcagtggtacaaggaggatacacctctgtccccgtcagaaaagttcaagatggtgctggagggccagatggcagagctgcgtatactccggcttactccagctgatgctggggtctaccggtgccaggcgggtagtgcccagagcagtgccgaggttactgtggaagctcgggaggtgacagtgatccagccactgcaggatgtggaagccatggaggaaggccgggtctgcttctcctgtgagctatctcataaggacgaggatatcgaatggtcactcaatggtacacccctgtactcggacagcttccacgagatcagccatgagggctgtctccacacgctggtgctgaagagtgtccggcaggctgacacgggcaccgtgtgtgccacctctcccaaggtgtcagtttctgcccggctggtggttaaagcaaagccagtggtgttcctaaaagcactggatgacgtatctgcagaagagcggggcacgctgaccctgcagtgcgaggtctccgacccggaggcgcgtgtggtttggcgcaaagatggtgtggagttgggtcccagcgacaagtatgacttcctacacaaggcaggtgttcggagccttacggtccatgacatgagccacgaggatgctggactgtacacctgccaggtgggcagtaaggagacccagtccagggtcagcgtgcatgaccttcatgtgggcatcaccaagaggttaaagacggtggaggtgctggagggagagagctgcagctttgagtgtgtcctctcccatgagagtcccagtgacccagcagtgtggacagttggtgggaagatagtgcgtagttctgaccacttccaggccgtacggcagggccgcaaatacactctgacagtcaaagatgctgccctcagtgatgcaggagaggtggtcttctcagtgctgggcctcacatccaaggcctcgctcatcatcagagagaagccagtggacatcacaaagcccctggaggaccagcacactacgcctggggaagatgtgatgctaagctgcgagctctctagggcaggctcctccgtgcgctggctgaaagacgggaaggccatccggaagagtcagaagtatgacctgctcattgaaggcacacaggctgtgttggttgtccgaaaggcctcgctcaaggattctggagaatacacctgtgagacagaagcctccagaagcactgccaggctgtgtgtggaagaaaagacaaaccggttcacggaggagctggctgacctgcaggtagaagagaagggcagagctgtgttcacatgcaagacagagcaaccggcatctattgtgacctggcgcaaaggcctcctggagctgcgcgcctcagggaagcatgtccccagccaggagggtttgaccctgacgcttactatcaatgccctggagaggacagacagtgacacttacacctgtgacattggccaagcccggacccaggcccggctcctcgtccatggccagaaagtacgagtcattgaggacctagaggacaccgctgtccaggagggctcctctgccaagttttgctgccgcatctcccctgctgactacggccctgtgcactggttcctggataagacccctttgcacagcaacgagctgaacgagatcactgtccagtccggaggctaccacgtgctcaccctgcggcagctgacgctcaaggattcaggcacggtctacttcgaggcgggtgaccagcggacctcagctgccctgcgggtgactgagaagccgagcatcttctctcggccactcacagatgtcacagtcacagaaggcgaggacctgactctcgtctgtgaaaccaccaccccggatagctctgtgcgctggaccaaagatgggaagacactgaggccatctgcacgatgccagctgaaccgcgaaggctgtcaggcccagctggtcatcactggcactaccctacaggatggcgggcggtacaaatgtgaggtgggcggagcctccagcagctccattgtcagggttcacgctcggccagtgcggttcagggagtccctgaaggacatggaggtgccagagggcaaggctgccacactacgctgtgtgctgtcatccgtggctgcacctgtggagtggcgtcacggagatgatgtcctgaaatccagcaacaagtatagcctgcgccaagagggtgctgtgctggaactggtcatccgagacctgaagccccaggacagcgggcagtactcatgctcctttggggaccagacaacttcagccacactcacagtgaaaacctcgtctgcccagttcataggaaaactgagaaacaaggaggccacagaagggaccatggccacacttcggtgtgagctgaccaaagaggcccccgtggaatggaagaagggaacagagaccctgagaaatggggacaaatacagtctgaagcaggatggagctgtgtgtgaactgcagatctgtaacctgcttgtggcagacgcgggggagtacttgtgtgtatgcgggcaggagaagacttcagccacgctgactgtcaaggccgttcctgtccactttatcagaaggctcaggaacaaggaggccacagaaggggacacggtcacactgcagtgtgaactgagcaaggcggcccccgtggagtggaggaagggaacagagaccctgagagatggggacagatacagcctgaagcaggatggggccgtgtgtgagctgcagatccgcagcctggctgtagcagatgctggagagtacttgtgcatgtgtggacaggaaaagacctcagccacactgaccatcagggcccttccagccagattcatagaagatttgagaagccaagaggtcccggaaagttcaacagtcacaatgcggtgtgagctaagcaagaaggcccctgtggtgtggaggaaagggtctgagaccctgaaaaatggggccaggtacagcctgagacaggatggtgctgtgtgtgagctggagatccgtgacctgactgtggaagatgctggagagtactcatgcacatgtgggaaggagaggacctcagccacactgagcattatggctccacaggtggtgttccagaagttactggagaatctgcaagcagaagaaggctccacagccagcctgcggtgtgagctgtcagtccccaacactgctgtggtctggagcaagggcggcctggagctgcaggctgacacatgccgagagacacggcagcagggctgcgttgcagaactgctgcttagggacgtgcgccgtgaggacgcgggcgagtacagctgtacctgtggttcccagaccacaagtgccacactcatggtcacagctgctcctgtgaggttcctccaggagctacaggcccaggacgtagatgaagggaccaccgcacgcctgcgctgtgagctgagccgggaggctgcgagtgtggaatggcgcaagggctccttgcagctttttccttgtgctaagtatcagatggtgcaggagggcacaactgcagagctgctagtccatggggtggagcaggaggatgcaggggaatacacctgcgatgcaggacacatgcagagcattgccaggctctccgtccgagcccccaagcccaagttcaagaccggcctacagagcaaagagcaagaagcaggtggcacagcacggctgtgttgtcaactgagcgaagctgagtcggggactccagtacaatggctcaaagagggggtggagctgcatgtcagctccaagtacgagatgcggtgccaaggggctatgtgtgagttgctgatccacaagctggaggccaaggacactggtgaatatgcctgcgtggtgggtggccagaagaccttggcctccctcagagtcaaagagcctgaggtgaccattgtgcagggactggtggacatggaggtgcaggctgatgaggatgtggagttcacttgcaaggtgtcacaggcaggagccacagatgtgcagtggcatctccaaggtctgccactgcagagcaatgaagtgacagaggtggctgttcttggagacggctgtacccatgtgctccagttgaagggtgtgacactggatgatgctggtactgtctccttccacgtgggcagccattcatcttctgctcagctcatagtccgagtccccgaggtgaccgttctggagcccctgaaggatgtgcagctcagcgagggccaggatgcccatttccagtgccggctgtccagggcttcgggccaggaggctcgctgggctttgggaggagttcccttgcagtgcaatgagatgaatgacatcactgtggagcagggcacactctactcgctcactctgcacaaggtgaccctcgaggatgccggaaccatcactctccaagtgggctcatgctcctcagaggcccagctgaaggtcacagaggcagcactgtgcctggtacgaggcttgcagaatgtggatgtcttcgcgggggaggtggccacgttctcctgtgaggtatctcgagcaggtgggccagaggcccgctggtggctggatggcaccctgcttcagaacagccctgagagtgccatgactgtacgagagggtactgttcactccctcacgctctcgggcctgggggtggctgactcaggcaccatcaccttccgcacggggcccctggtctccacagccaagttattggtcaaagatcccacagtggaggtggtgagtgccatgcaggacctggtggtggaggagggtggctcggccgagctcctctgccagtactcgcggcccgtgcaggccatgtggaagatgaacgagcgggaggtgtgcgcggatgggcaccgtgtcatcatagagcaggactggaccgtagccaggctgaccctcaggccggccctgccctgtgacagtggcatctattcttgtgaggctgcgggcactcgagttgtggcactgctccaagtgcaagccaagaacacagtggtgcgtggcctggagaatgtggatgcactggagggcggcgaagctctgttcgagtgtcagctgtcccagccggaagtggctgcccacacctggttactagacgatgagcctgtgcacacatcagcaaacgtggaggtggtctactttgagaacggactgcgccacttgcttttgctcaaaaacctgaagccacaggacagctgccgagtgaccttcctggcaggggacgtggtcacgtctgccttcctcactgtgagaggctggcgcttggaggtcctggagcccccacaagacgcatctgtgaaagctggtacgcaggtctgcttcacttgcatactaagtgaggccctgcctgtgggcgaggctacttggtacatcaacggggctgccatccaacctgatgacgctgactggatagtcaccgcagatggcagccaccatgccctgacgctgagcaacgcccagccccagcacgcaggagaggtcacatttgcagcacgtgacgccgtggcctctgcacgcctctctgtgttggctctccctggtccccctgaagatgctgaagtagtgggtcgaagtgaccactctgtgaccctatcctgggtggctcccgtgagtgacggcggcggcggtctatgtggttatcgtgtggagatgaaggaggcatccacaggccagtggcagttgtgccatgagttggtacctggcccagagtgtgtggtggacggcctggtctctgggaagacctaccgcttccgagtggcagccgtgggtccggcaggagctggggagcctgtacatctgccccagatggtcaagatagcagagccaatggaacctaaaccagccccagccccagcccctgccctagccccaaccccagctccaatcccaaccccagccccagccccagccccagccccaaccccagccccaaccccaaccccagccccagccccagcccctgccccagccccagcaacacggcgagcagtggttggtgaagatgtgtgtctggagctggaagtggcagctgatgctggcgaggtcgtctggcacaagggaacagagcgcatccatcccagtgggcactttgaggtcctctctcagggtcagcggcagatgctggtgatcaagggctttaggaccgaagaccagggggagtaccgctgtggtcccatccagggcctgccctcctcaggagcttctactttcaatgtggtcgtgacctcgggctcggaggatgaggtccctgcacagcccagcctgcctcccgaggcagcccaggagggtgacctgcatctgctttgggaggcccttgctcggaagcgtcgcatgagccgggagcccacgctggactccatcagtgagctgcccgaggaagacagccgtgtgcagcatctgcggcaggaggcagaagaggcggctcctgacctctctgagggctactccacagccgatgagctcgcacgcacaggagaagctgacctctcacacaccagctctgatgacgagtctcgggctggcaccccttccctaattacctacctcaagaaggccgggggtcctgggatctcacccttggccagcaagcatgaggcccaggtggccacgtctgtgaagccacaaaagcagcaggagcgggttgtgcccacatgcccactgccgggagatttgaacgcagcagatttgaaggatccatccctggacaaggccgctgtgaagatccaggctgcctttaagggctacaaagtgaggaaggagatgaagcagcagggaggccccgtgttctcacggacatttggggacacagaggcacaggttggggatgcgctgcggctggagtgtgtggtgtccaccaaggctgacgtgcgggcctgctggttgaaggatggcgtagagttaacagatgggcgccattaccacatagaccagctcaaggacggtacctgctctctgctggtcactggcctgggccccactgactctggtcgctacacctgtcaggtgagcaccaagtttggaagcgtgagccacagtgcctgcgtaatggtcagtgggacagaaagtgaggctgagagctcctcaggaggtgagctggacgatgccttccgccgggcagcacgacgcctgcatcgtctcttccgaaccaagagcccagctgagctttcagaagaggagctcttcctcagtgctgacgaaggccccatggagccagaggagcctgcagactggcaaacataccgagaggatgaaaactttgtgtgcatccgttttgagtcacttgcagaggcccaccgggcagtcacctgcttccgtgacatgtttgccaccatgggcatcggggtggagatcagcctaggggagcaggggccccggggagtggagatgcgcattggcaaggtggcccccactgtcatccctgcggtgccacttgcaaagacacctggcctgcagacttcagatgctgccccagtgttcctgacggagctgcagaaccaagacgtgcaggacggataccccatgagcttcgactgcgtggtaacaggccagcctgtgcccagtgtgcgctggttcaaggacgggaagttgctagaagaggatgaccactacatgatcaacgaggaccaacaggggggtcaccagctcatcatcacagccgtggtgccggcagacatgggagtgtaccgctgcctggcggagaacagcatgggcgtctcctccaccaaggctgagcttcgtgtggaattgaccagcacagactatgacactgctgctgatgctaccgagacctcatcctacttcagcgcccagggatacctgtccagccgggagcaagaggggacggagtcagatgaggggcagcttccccaggtgctggaggaactgaaagacctccaggtggcccctggcacacgcctggccaagttccagctcaaggtgaaaggttatccagctcccaaactgtactggttcaaagatggccagcccctgaccacatctgaccacatccgcatgactgacaaaaagaccctgcacaccctggagattgtctccatcacccgagaggacagcggccagtacgcggcctacatcagcaatgctgtgggtgccgcctattcgtcagcccggctgctggtccgaggtcccagtgaaccagaagagaagccacaaccagatgttcatgagaggctggtgccaccccgaatcctggagaagttcacccccaagaaagtgaagaggggctccagcatcaccttttcagtgaaggtggaaggacacccggcccccagtgtgcattggctcaaggaggaggcagagaagggagtcctgtggattggccctgatacccctggctacacgatggccagttcttccaagcaacatagcctggtcctgctggacgtaggccgacagcaccagggcacctacacgtgcattgccaccaatgctgctggccaggcgctctgctctgccagtctgcacatctctggcttggccaaagaagaggagcaggagagagtgaaggaggctctcatttcctccttcctgcaagggacgagccaagctgtctcagcccagatgtcagaatctgcaagttttgctgatcttgtcgggcaaaggaaaggtgagtccctggtggctgaggaggcccacagtcacctgtccctttctgaggtgggcacagaagagttcctgcagaaactcacctcacagatcaccgagatggtatcagccaagatctcgcaggccaaactccaggtgcctggaggtgacagtgatgaggagtctaagacaccatctgcttctcctcggcacggccggtcacgtccttcctccagtgttcaagagtcttcctcagagtcagaggatggagactcccgtggtgagatctttgacatctacgtggtcacagctgattatctgcccctgggagctgagcaggatgccatcatcctgagagaaggccagtatgtggaggtcctggactcagcccatcccctgcgctggcttgtacgcaccaagcccaccaaatccagcccttccaggcagggctgggtgtcacctgcctacctggacaagaggctcaagctatctcctgagtgggggcccactgaggcccctgagttccctggcgaggctgtgtctgaggatgagtatagaacgaggctgagctctgtcatccaggagttgctgagttcagagcaggcttttgtgggtgagttacagttcttggagagccaccacatcaagcacctggaccgatctccccgtgtacccgcagctgtggccagccagaagacggtcatctttcgtaatgtgcaggacatcagccatttccacagcagcttcttgaaggagctgcagagctgtggcaccgacgatgatgtagccatgtgcttcatcaagaaccaggaggcctttgagaagtaccttgagttcctggtgggccgggtgcaagcggaatcagtggtcgtcagcaccccagtccaggagttctacaagaaatatgcagaagagatgctgtcagccaaggaccccacacagccacccccacctcctcttcagcactacttggagcagccagtggaacgggtgcagaaataccaggccttgctgaaggagctaatccgcaacaaggctcgcaaccggcagaactgtgcgctgctggagcaggcctacgctgtggtgtctgccctgcctcagcgtgctgagaacaagctgcacgtttctctcatggagaactacccgggaaccctggaggccctgggagaacctatccgccagggtcacttcatagtgtgggagggggctccaggagcccggatgccttggaagggccacaaccggcatgtcttcctcttccgaaaccacctggtgatctgcaagccccggagagactctcgaacggacaccttcagctacgtgttccggaacatgatgaagctgaatagcatcgacctgaatgaccaggtagagggggatgaccgtgcctttgaggtgtggcacgagcgggaagactctgtccgcaagtacctgctgcaggcgcggacagtgatcatcaaaaactcatgggtgaaggagatctgtggcatccagcagcgccttgcccagcccgtgtggcgtccccctgagtttgaagaagaactagctgactgcacagccgagctgggtgaaacagtcaagctagcatgccgagtgactggcacacctaagcctattgtcagctggtacaaagatgggaagcccgtggaggtggacccacaccacatcctcattgaagaccctgatggctcctgtaccctcatcttggacaaccttactggcatagactctggccagtacatgtgttttgcggccagtgctgctggcaatgccagcaccttggggaagattctagtacaagtgcccccacgatttgtgaacaaggtccgagccacaccctttgtggagggagaggacgcgcagatcacctgcacagtggaaggagctccgtaccctcagatcaggtggtacaaggacggtgccctgctaaccctgggcaacaggtaccggatggtgaatgagccccgcagtggtatgctggtgctggtgatccaggcagccagcaaggaggacctgggacactatgaatgtgagttggtgaaccggttgggctcaacacgttgtggcggagaattatacatgcagagtcccgcactgcgtgcctgggaccagcaccaccgggaacagcttgtggctgctgtggaagacgcctccatggaggactctgcccaccccactcaggagggagctgaccaacaagccgcttctgtcctttggaggctgctgggctcagaagccctcagcccctccccagggggtttccccaacaccagacaaagtgagccacccacatcagaagaggctgctccccagatcccaggcacaacttcaggaacacctggcaaactcccagaggcttcacggcccggcacatacaaaggcctggagcaggggatgacaacaacttctggatcccaggaacggaatgtacccattcgggtggagggcacggcctggccaggcggaggcactgggcagctgctcttggatgtgcacagccaagtcatcatggagaccacacagaggacctatgtgtgccaagctcctgacacaggtgtcacaagggccccatccatgcaggtcactatcgaggacctacaagtacaagtgggtgacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtggaaggcctacactacctgcacagccatgatatcctccatctggacataaagccccccaacatcctgatggtccacccagctcgggaagacattaagatctgtgactttggctttgcccaaaagatcaccccgtcagagccacagtacagcaagtatggctcacctgaattcgtgtccccagagatcatcgagcagagtcctgtgagtgagggctcagacatctgggccatgggcgtcatctcctacctcagcctcacctgttcatccccattcgctggagagagtgaccgtgccaccctgctcaatgttttggaggggcgggtctcttggagcagtcccatggctgcccatctgagtgaggatgccaaggacttcatcaaggccacactgcaaaagacccccagggcccggcctagtgcttcccagtgccttgctcacccctggttcctgaagtccatgcctgctgaggaggcccacttcatcaacaccaaacagctcaagttccttcttgctcgcagtcgctggcagcgttccttgatgagctacaagtctatcctggtgatgcgctccatccctgagctgctccagggtcctccagacagtccatctctaggagtggcccggcacctacgaggggaagccagcggatcctctagctcatcgtcttcctcggacaatgagcttgccccatttgccagggctaagtcactgccaccttcccctgtcactcactcgccactgctgcaccctcggggctttctgcggccttcagccagcctcccggaggagacagaggccagcatgtccactgctgatgcagccatgccggcacccccccagagtgctgggcctccagcaagcccaggttgtgtgccccggcacagcgtcatcagcagcttgttctaccagcaagctggtgagggtgcagagcgtgggagcaaagcgttgggcgccaagaggcacccagctcggagacgccacctgctaaagggcgggtacattgcaagggccctgcccgggctacgagagccgctgatggagtttagtgtgttggaggaagaggctgctaatgaggagcaggcctctctgatgaccaagacaccctcctttgagaccgctctgcgactacctagttccaatgtcagagaggtcccaggccgaagccgctccctggacaacccaccaggcacagccagcccctctcctgaggcatacaaggaacaatacctgtccccaccctcctcggggttgactcatgaaaccaccgccaagggcatgggacacaaagaagggttcttgcaggagtctgtccccttttcacctaccagtggtgacctgaggcctgttaagcaagaggggtcatcccaggatagctgtagagggaaaccagcctcttcctgtcactctgaactgggttctggtccgcaggagggctgtggctctccatcatcacaattgtgtggctccttacctccacagtcatcgaagaaagagctctcaaaaccctgtggcccactcttttcagaacagcctcaggcagccccattcccagcgcaagcaagcccccttctgggttctcagaaggaacctcaggatagctatctacctgaaaagccatgtccagttccctccagttctccagggtcagcctcccaagtagatgcatccctggataccgaaggcttgtcggaagctggggacacatgtgacttcacgcctcctctccagcggcctcaggagcaggccaccacccggaagttctctctggaatcccgtgggggctatgcaggggtggcaggatatggcaccttcgcctttggtggggatgcaggggggatgttagggcagggtcccctttgggccaggatggcctgggctgtgtcccagtcctcagaagagcaagatgaagcagcgactgagagccctcaacctctggacagctcagggcccattgctgaggccagtggggttcccctaaggacctcgccaagcctcaccccatgggaggaagttgagcaggtttccctggtacagatccgggatctgtctggtgatgcagaagcagccgacaccatctccttggacatttcagaggtagatcctgcctacctcaacctctccgatctatatgacatcaagtatctcccgtttgagttcatgatcttcaggagggtccccaaacctgtagagcagccagagtcacctggctctgaaactgaagaggggcaagggctggcggagttcctggaggaggctgtgtggccctggccaggcgagctgggactgcgtgctggtctggagattacagaggagccacaggagccaggggacctggaagcactgctgggcgaggctgctgtgggcaggaagcgcaagtggtccccctcccgtggcctcttccaattccctgggaggtgcctgtcaggggaggagcccgtggagcttgggctgcgccagagggtgaaggcttccatggctcacatctccaggatcctgaagggcaagccggaaggtcctgagaaggaagggcctcccagaaagaaggcaggcctagcttctttccggctatcaggcctgaagggcagggaccaagcgccatccttcctaagagaactctctgatgaggctgtggtcctgggccaatcagtgacactggcctgccaggtgttggcccagccaactgcccaggctacctggagcaaagatggggcccttctggagagcagcggccacctcctcatctcttccaccctgaagaacttccagctgctgaccattctggtggtgacggaggaggatctgggcacatatacctgctgtgtgagcaacccactagggacagcagtcaccacaggtgtcctccggaaagcagagcgcccttcatcttctccacgcccggaggtgggggaactatacacggatgcagtgttgctggtctggaagcctgtggaatcctatggcccagtgacctacattgtgcagtgctgtatagaaggaggcagctggacaaccctggcctctgacatctccgactgctgctacctcactggcaagctgccccggggtggcatgtataccttccggacagcatgtgtcagcaaagcaggaatgggcccctacagtagcccctcagaacaggtcctccttggaggacccaaccacctggcttctgaggaggaaagcagccgggggagaccagcccagcttcttcccagcacaaagacttttgccttccagacacagatccggaggggccgcttcagtgtggtgaggcagtgtagggagaaagcaagtgggcgggccctggctgctaagatcgttccctaccagcctgaggacaagacaactgtactaagagaatatgaggcactaaagagactgcaccacccacatctggcccaactccatgctgcctacctcagtccccggcacctggtgctcatcctagagctgtgctctggccctgagctgctaccctctctggcggagagggactcgtactcagagtctgatgtgaaggactacctgtggcagatgctcagtgccacccagtacctgcatgcccaacacatcctgcacctggacctgaggtcggagaacatgatggtcaccgagtacaacctgcttaaggttatagacctgggtaacgcccagagtctcagccaagagaaggtcccacctcctgaaaacttcaaagactacctagagaccatggctccagaacttctggaaggccaaggggcggttccacagacagacatctgggctattggtgtaacagccttcattatgctgagtggcgagtacccagtgagcagcgaggggactcgcgacctgcagaaaggcctgcgcaagggactcattcaattgagtcgctgctatgcaggattatcagggggtgcggtagccttcctgcagagttcattgtgcgctcggccctggggtcgcccgtgcgcttccacctgcttgcagtgcgggtggctgacggaggagggccccaccggttcccggcccacgcccgtgaccttccccaccgcgcgattgcgtgcctttgtgcgcgagcgcgagaagcgccgggcgctactctacaagaagcacaacctggctcaggtgcgctgaggcccagccctacagagcaagatgtgcccgccaataaaagatgcaaaacagcca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]