LOCUS       NR_031942                 82 bp    RNA     linear   ROD 02-APR-2024
DEFINITION  Rattus norvegicus microRNA 298 (Mir298), microRNA.
ACCESSION   NR_031942
VERSION     NR_031942.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 82)
  AUTHORS   Liu,L., Li,J., Wang,R., Wang,Y. and Wang,G.
  TITLE     MicroRNA-298 Exacerbates Myocardial Ischemic Injury via Targeting
            Cyclin D1
  JOURNAL   Pharmazie 74 (6), 369-373 (2019)
   PUBMED   31138376
  REMARK    GeneRIF: Overexpression of miR-298 may exacerbate myocardial
            ischemic injury by targeting cyclin D1 and regulating the
            activation of PTEN/PI3K/AKT signaling pathway.
REFERENCE   2  (bases 1 to 82)
  AUTHORS   Zhang,Q., Yu,N. and Yu,B.T.
  TITLE     MicroRNA-298 regulates apoptosis of cardiomyocytes after myocardial
            infarction
  JOURNAL   Eur Rev Med Pharmacol Sci 22 (2), 532-539 (2018)
   PUBMED   29424914
  REMARK    GeneRIF: The up-regulation of miR-298 significantly improved the
            cardiac function, decreased the expressions of BAX, reduced the
            myocardial apoptosis and inhibit the apoptosis proteins expression
            including cytochrome-c and cleaved caspase-3.
REFERENCE   3  (bases 1 to 82)
  AUTHORS   Zhang,Q., Liu,H., McGee,J., Walsh,E.J., Soukup,G.A. and He,D.Z.
  TITLE     Identifying microRNAs involved in degeneration of the organ of
            corti during age-related hearing loss
  JOURNAL   PLoS One 8 (4), e62786 (2013)
   PUBMED   23646144
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 82)
  AUTHORS   Polikepahad,S. and Corry,D.B.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   5  (bases 1 to 82)
  AUTHORS   Chew,W.S., Poh,K.W., Siddiqi,N.J., Alhomida,A.S., Yu,L.E. and
            Ong,W.Y.
  TITLE     Short- and long-term changes in blood miRNA levels after nanogold
            injection in rats--potential biomarkers of nanoparticle exposure
  JOURNAL   Biomarkers 17 (8), 750-757 (2012)
   PUBMED   23030236
  REMARK    GeneRIF: Data indicate that rno-miR-298 was confirmed to be
            increased at 1 week postinjection of gold nanoparticle (AuNP).
REFERENCE   6  (bases 1 to 82)
  AUTHORS   Tarantino,C., Paolella,G., Cozzuto,L., Minopoli,G., Pastore,L.,
            Parisi,S. and Russo,T.
  TITLE     miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic
            stem cells
  JOURNAL   FASEB J 24 (9), 3255-3263 (2010)
   PUBMED   20439489
REFERENCE   7  (bases 1 to 82)
  AUTHORS   Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   8  (bases 1 to 82)
  AUTHORS   Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A.,
            Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C.,
            Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R.,
            Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B.,
            Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De
            Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G.,
            Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G.,
            Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T.,
            Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A.,
            Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   9  (bases 1 to 82)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAXUCZ010000003.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-82                JAXUCZ010000003.1  183470522-183470603 c
FEATURES             Location/Qualifiers
     source          1..82
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3q43"
     gene            1..82
                     /gene="Mir298"
                     /gene_synonym="rno-mir-298"
                     /note="microRNA 298"
                     /db_xref="GeneID:100314250"
                     /db_xref="miRBase:MI0000969"
                     /db_xref="RGD:2325373"
     precursor_RNA   1..82
                     /gene="Mir298"
                     /gene_synonym="rno-mir-298"
                     /product="microRNA 298"
                     /db_xref="GeneID:100314250"
                     /db_xref="miRBase:MI0000969"
                     /db_xref="RGD:2325373"
     exon            1..82
                     /gene="Mir298"
                     /gene_synonym="rno-mir-298"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           11..33
                     /ncRNA_class="miRNA"
                     /gene="Mir298"
                     /gene_synonym="rno-mir-298"
                     /product="rno-miR-298-5p"
                     /db_xref="miRBase:MIMAT0000900"
                     /db_xref="GeneID:100314250"
                     /db_xref="miRBase:MI0000969"
                     /db_xref="RGD:2325373"
     ncRNA           52..73
                     /ncRNA_class="miRNA"
                     /gene="Mir298"
                     /gene_synonym="rno-mir-298"
                     /product="rno-miR-298-3p"
                     /db_xref="miRBase:MIMAT0017166"
                     /db_xref="GeneID:100314250"
                     /db_xref="miRBase:MI0000969"
                     /db_xref="RGD:2325373"
ORIGIN      

ccaggccttcggcagaggagggctgttcttcccttgggttttatgactgggaggaactagccttctctctgcttaggagtgg

//