2024-11-23 10:33:49, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NR_031778 96 bp RNA linear ROD 02-APR-2024 DEFINITION Rattus norvegicus microRNA 331 (Mir331), microRNA. ACCESSION NR_031778 VERSION NR_031778.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 96) AUTHORS Gitai,D.L.G., Dos Santos,Y.D.R., Upadhya,R., Kodali,M., Madhu,L.N. and Shetty,A.K. TITLE Extracellular Vesicles in the Forebrain Display Reduced miR-346 and miR-331-3p in a Rat Model of Chronic Temporal Lobe Epilepsy JOURNAL Mol Neurobiol 57 (3), 1674-1687 (2020) PUBMED 31813125 REMARK GeneRIF: Extracellular Vesicles in the Forebrain Display Reduced miR-346 and miR-331-3p in a Rat Model of Chronic Temporal Lobe Epilepsy. REFERENCE 2 (bases 1 to 96) AUTHORS Lee,H., Jee,Y., Hong,K., Hwang,G.S. and Chun,K.H. TITLE MicroRNA-494, upregulated by tumor necrosis factor-alpha, desensitizes insulin effect in C2C12 muscle cells JOURNAL PLoS One 8 (12), e83471 (2013) PUBMED 24349514 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 96) AUTHORS Wu,S.C., Yang,J.C., Rau,C.S., Chen,Y.C., Lu,T.H., Lin,M.W., Tzeng,S.L., Wu,Y.C., Wu,C.J. and Hsieh,C.H. TITLE Profiling circulating microRNA expression in experimental sepsis using cecal ligation and puncture JOURNAL PLoS One 8 (10), e77936 (2013) PUBMED 24205035 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 96) AUTHORS Zhang,Q., Liu,H., McGee,J., Walsh,E.J., Soukup,G.A. and He,D.Z. TITLE Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss JOURNAL PLoS One 8 (4), e62786 (2013) PUBMED 23646144 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 96) AUTHORS Polikepahad,S. and Corry,D.B. TITLE Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2 JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013) PUBMED 23185045 REFERENCE 6 (bases 1 to 96) AUTHORS Medrano,S., Monteagudo,M.C., Sequeira-Lopez,M.L., Pentz,E.S. and Gomez,R.A. TITLE Two microRNAs, miR-330 and miR-125b-5p, mark the juxtaglomerular cell and balance its smooth muscle phenotype JOURNAL Am J Physiol Renal Physiol 302 (1), F29-F37 (2012) PUBMED 21993888 REFERENCE 7 (bases 1 to 96) AUTHORS Tarantino,C., Paolella,G., Cozzuto,L., Minopoli,G., Pastore,L., Parisi,S. and Russo,T. TITLE miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells JOURNAL FASEB J 24 (9), 3255-3263 (2010) PUBMED 20439489 REFERENCE 8 (bases 1 to 96) AUTHORS Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E. TITLE Small RNA expression and strain specificity in the rat JOURNAL BMC Genomics 11, 249 (2010) PUBMED 20403161 REMARK Publication Status: Online-Only REFERENCE 9 (bases 1 to 96) AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and Enright,A.J. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 REFERENCE 10 (bases 1 to 96) AUTHORS Kim,J., Krichevsky,A., Grad,Y., Hayes,G.D., Kosik,K.S., Church,G.M. and Ruvkun,G. TITLE Identification of many microRNAs that copurify with polyribosomes in mammalian neurons JOURNAL Proc Natl Acad Sci U S A 101 (1), 360-365 (2004) PUBMED 14691248 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from JAXUCZ010000007.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: SRR26360176.2256822.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-96 JAXUCZ010000007.1 30414386-30414481 c FEATURES Location/Qualifiers source 1..96 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="7" /map="7q13" gene 1..96 /gene="Mir331" /gene_synonym="rno-mir-331" /note="microRNA 331" /db_xref="GeneID:100313975" /db_xref="miRBase:MI0000608" /db_xref="RGD:2325619" precursor_RNA 1..96 /gene="Mir331" /gene_synonym="rno-mir-331" /product="microRNA 331" /db_xref="GeneID:100313975" /db_xref="miRBase:MI0000608" /db_xref="RGD:2325619" exon 1..96 /gene="Mir331" /gene_synonym="rno-mir-331" /inference="alignment:Splign:2.1.0" ncRNA 7..25 /ncRNA_class="miRNA" /gene="Mir331" /gene_synonym="rno-mir-331" /product="rno-miR-331-5p" /db_xref="miRBase:MIMAT0017033" /db_xref="GeneID:100313975" /db_xref="miRBase:MI0000608" /db_xref="RGD:2325619" ncRNA 61..81 /ncRNA_class="miRNA" /gene="Mir331" /gene_synonym="rno-mir-331" /product="rno-miR-331-3p" /db_xref="miRBase:MIMAT0000570" /db_xref="GeneID:100313975" /db_xref="miRBase:MI0000608" /db_xref="RGD:2325619" ORIGIN
gagtctggtcttgtttgggtttgttctaggtatggtcccagggatcccagatcaaaccaggcccctgggcctatcctagaaccaacctaaacccat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]