LOCUS       NM_019247               1234 bp    mRNA    linear   ROD 27-MAR-2024
DEFINITION  Rattus norvegicus paired-like homeodomain 3 (Pitx3), mRNA.
ACCESSION   NM_019247
VERSION     NM_019247.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1234)
  AUTHORS   Shi,W., Zhang,Y., Zhao,G., Wang,S., Zhang,G., Ma,C., Cong,B. and
            Li,Y.
  TITLE     Dysregulation of Dopaminergic Regulatory Factors TH, Nurr1, and
            Pitx3 in the Ventral Tegmental Area Associated with Neuronal Injury
            Induced by Chronic Morphine Dependence
  JOURNAL   Int J Mol Sci 20 (2), 250 (2019)
   PUBMED   30634592
  REMARK    GeneRIF: a significant reduction in expression of the dopaminergic
            regulation factors Nurr1 and Pitx3 could not effectively regulate
            TH in the VTA during chronic morphine dependence, which affects the
            survival of dopaminergic neurons and ultimately leads to neuronal
            pathology.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1234)
  AUTHORS   Green,A.L., Zhan,L., Eid,A., Zarbl,H., Guo,G.L. and Richardson,J.R.
  TITLE     Valproate increases dopamine transporter expression through histone
            acetylation and enhanced promoter binding of Nurr1
  JOURNAL   Neuropharmacology 125, 189-196 (2017)
   PUBMED   28743636
REFERENCE   3  (bases 1 to 1234)
  AUTHORS   Wada,K., Matsushima,Y., Tada,T., Hasegawa,S., Obara,Y.,
            Yoshizawa,Y., Takahashi,G., Hiai,H., Shimanuki,M., Suzuki,S.,
            Saitou,J., Yamamoto,N., Ichikawa,M., Watanabe,K. and Kikkawa,Y.
  TITLE     Expression of truncated PITX3 in the developing lens leads to
            microphthalmia and aphakia in mice
  JOURNAL   PLoS One 9 (10), e111432 (2014)
   PUBMED   25347445
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1234)
  AUTHORS   Veenvliet,J.V., Dos Santos,M.T., Kouwenhoven,W.M., von Oerthel,L.,
            Lim,J.L., van der Linden,A.J., Koerkamp,M.J., Holstege,F.C. and
            Smidt,M.P.
  TITLE     Specification of dopaminergic subsets involves interplay of En1 and
            Pitx3
  JOURNAL   Development 140 (16), 3373-3384 (2013)
   PUBMED   23863478
  REMARK    Erratum:[Development. 2013 Oct;140(19):4116]
REFERENCE   5  (bases 1 to 1234)
  AUTHORS   Garcia-Perez,D., Saez-Belmonte,F., Laorden,M.L., Nunez,C. and
            Milanes,M.V.
  TITLE     Morphine administration modulates expression of Argonaute 2 and
            dopamine-related transcription factors involved in midbrain
            dopaminergic neurons function
  JOURNAL   Br J Pharmacol 168 (8), 1889-1901 (2013)
   PUBMED   23215787
REFERENCE   6  (bases 1 to 1234)
  AUTHORS   Lebel,M., Gauthier,Y., Moreau,A. and Drouin,J.
  TITLE     Pitx3 activates mouse tyrosine hydroxylase promoter via a
            high-affinity binding site
  JOURNAL   J Neurochem 77 (2), 558-567 (2001)
   PUBMED   11299318
REFERENCE   7  (bases 1 to 1234)
  AUTHORS   Rieger,D.K., Reichenberger,E., McLean,W., Sidow,A. and Olsen,B.R.
  TITLE     A double-deletion mutation in the Pitx3 gene causes arrested lens
            development in aphakia mice
  JOURNAL   Genomics 72 (1), 61-72 (2001)
   PUBMED   11247667
REFERENCE   8  (bases 1 to 1234)
  AUTHORS   Cazorla,P., Smidt,M.P., O'Malley,K.L. and Burbach,J.P.
  TITLE     A response element for the homeodomain transcription factor Ptx3 in
            the tyrosine hydroxylase gene promoter
  JOURNAL   J Neurochem 74 (5), 1829-1837 (2000)
   PUBMED   10800925
REFERENCE   9  (bases 1 to 1234)
  AUTHORS   Semina,E.V., Ferrell,R.E., Mintz-Hittner,H.A., Bitoun,P.,
            Alward,W.L., Reiter,R.S., Funkhauser,C., Daack-Hirsch,S. and
            Murray,J.C.
  TITLE     A novel homeobox gene PITX3 is mutated in families with
            autosomal-dominant cataracts and ASMD
  JOURNAL   Nat Genet 19 (2), 167-170 (1998)
   PUBMED   9620774
REFERENCE   10 (bases 1 to 1234)
  AUTHORS   Smidt,M.P., van Schaick,H.S., Lanctot,C., Tremblay,J.J., Cox,J.J.,
            van der Kleij,A.A., Wolterink,G., Drouin,J. and Burbach,J.P.
  TITLE     A homeodomain gene Ptx3 has highly restricted brain expression in
            mesencephalic dopaminergic neurons
  JOURNAL   Proc Natl Acad Sci U S A 94 (24), 13305-13310 (1997)
   PUBMED   9371841
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000001.1.
            
            On Nov 23, 2020 this sequence version replaced NM_019247.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AJ011005.2, SRR26643296.4642.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760386, SAMEA5760475
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-41                JAXUCZ010000001.1  254955285-254955325 c
            42-171              JAXUCZ010000001.1  254944244-254944373 c
            172-374             JAXUCZ010000001.1  254943862-254944064 c
            375-1234            JAXUCZ010000001.1  254942608-254943467 c
FEATURES             Location/Qualifiers
     source          1..1234
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q54"
     gene            1..1234
                     /gene="Pitx3"
                     /note="paired-like homeodomain 3"
                     /db_xref="GeneID:29609"
                     /db_xref="RGD:3332"
     exon            1..41
                     /gene="Pitx3"
                     /inference="alignment:Splign:2.1.0"
     exon            42..171
                     /gene="Pitx3"
                     /inference="alignment:Splign:2.1.0"
     CDS             54..962
                     /gene="Pitx3"
                     /function="homeodomain, transcription factor"
                     /note="homeobox protein PTX3; homeobox protein PITX3;
                     paired-like homeodomain transcription factor 3"
                     /codon_start=1
                     /product="pituitary homeobox 3"
                     /protein_id="NP_062120.1"
                     /db_xref="GeneID:29609"
                     /db_xref="RGD:3332"
                     /translation="

MEFGLLGEAEARSPALSLSDAGTPHPPLPEHGCKGQEHSDSEKASASLPGGSPEDGSLKKKQRRQRTHFTSQQLQELEATFQRNRYPDMSTREEIAVWTNLTEARVRVWFKNRRAKWRKRERSQQAELCKGGFAAPLGGLVPPYEEVYPGYTYGNWPPKALAPPLAAKTFPFAFNSVNVGPLASQPVFSPPSSIAASMVPSAAAAPGTVPGPGALQGLGGAPPGLAPAAVSSGAVSCPYASAAAAAAAAASSPYVYRDPCNSSLASLRLKAKQHASFSYPAVPGPPPAANLSPCQYAVERPV"

     misc_feature    54..266
                     /gene="Pitx3"
                     /note="propagated from UniProtKB/Swiss-Prot (P81062.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    207..209
                     /gene="Pitx3"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:16641100; propagated from
                     UniProtKB/Swiss-Prot (P81062.2); phosphorylation site"
     misc_feature    222..224
                     /gene="Pitx3"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:16641100; propagated from
                     UniProtKB/Swiss-Prot (P81062.2); phosphorylation site"
     misc_feature    240..410
                     /gene="Pitx3"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    <477..>761
                     /gene="Pitx3"
                     /note="Sec24-related protein; Provisional; Region:
                     PTZ00395"
                     /db_xref="CDD:185594"
     misc_feature    825..878
                     /gene="Pitx3"
                     /note="OAR motif; Region: OAR; pfam03826"
                     /db_xref="CDD:461067"
     misc_feature    837..878
                     /gene="Pitx3"
                     /note="propagated from UniProtKB/Swiss-Prot (P81062.2);
                     Region: OAR.
                     /evidence=ECO:0000255|PROSITE-ProRule:PRU00138"
     misc_feature    855..869
                     /gene="Pitx3"
                     /note="propagated from UniProtKB/Swiss-Prot (P81062.2);
                     Region: Nuclear localization signal.
                     /evidence=ECO:0000255"
     exon            172..374
                     /gene="Pitx3"
                     /inference="alignment:Splign:2.1.0"
     exon            375..1234
                     /gene="Pitx3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ccacagccaccaccgggagtctgcctgctgcgggacacactagccctccctccatggagtttgggctgcttggtgaggcagaggctcgaagccctgcgctgtcattgtcagatgcaggcactccacaccctccgcttccagaacatggctgcaaggggcaggagcacagtgactcggagaaggcctcggcctcactgccggggggctcccctgaggatggctccctgaagaagaagcagcggcggcagcgcacgcacttcaccagccagcagctgcaggagctggaggccaccttccagaggaatcgctaccccgacatgagcacgcgcgaagagatcgccgtgtggaccaacctcactgaggcccgcgtgcgggtgtggttcaagaaccggcgcgccaagtggcggaagcgggagcgcagccagcaggcggagctgtgcaagggcggcttcgcagccccgctcgggggcctggtgccaccctacgaggaggtgtacccgggctacacgtacggcaactggccgcccaaggcgctcgccccgccgctcgccgccaagaccttcccgttcgccttcaactcggtcaacgtggggcctctggcttcacaacctgtattctcaccgcccagctccatcgctgcctccatggtgccctcggcggccgctgccccgggcaccgtcccaggtcccggagccttgcagggcctgggcggggcaccccccgggctggctccagccgccgtgtcctccggggcagtgtcctgcccttacgcctcggccgccgcagccgccgctgcagccgcctcctccccttatgtataccgggacccgtgtaactcgagcctggctagcctgcggctcaaagccaagcagcacgcctctttcagctaccccgccgtgcccgggccgccgccggccgctaaccttagtccctgccagtacgccgtggaacggccagtgtgaaccgcaggtctgtggatccatccccgagggcggggcagtaattcacagcctctctggacaggggtcgcctagactggcttgccctcgtcccagggtctgaaaaggggtgccagagcacccgggaagaggcggctccgaagagggccttttccctcacagcccctgaggggtggtctgacccctatacggagaccgcggccctgggactaaggccaggaacagggaccagctcccccggggccaattcacccttggctcaccccgccttctcc

//