GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-08-24 02:10:31, GGRNA.v2 : RefSeq release 230 (May, 2025)

LOCUS       NM_001438292            1295 bp    mRNA    linear   ROD 17-APR-2025
DEFINITION  Rattus norvegicus small nuclear ribonucleoprotein polypeptide A
            (Snrpa), transcript variant 3, mRNA.
ACCESSION   NM_001438292
VERSION     NM_001438292.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1295)
  AUTHORS   Fragoza,R., Das,J., Wierbowski,S.D., Liang,J., Tran,T.N., Liang,S.,
            Beltran,J.F., Rivera-Erick,C.A., Ye,K., Wang,T.Y., Yao,L., Mort,M.,
            Stenson,P.D., Cooper,D.N., Wei,X., Keinan,A., Schimenti,J.C.,
            Clark,A.G. and Yu,H.
  TITLE     Extensive disruption of protein interactions by genetic variants
            across the allele frequency spectrum in human populations
  JOURNAL   Nat Commun 10 (1), 4141 (2019)
   PUBMED   31515488
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1295)
  AUTHORS   Kondo,Y., Oubridge,C., van Roon,A.M. and Nagai,K.
  TITLE     Crystal structure of human U1 snRNP, a small nuclear
            ribonucleoprotein particle, reveals the mechanism of 5' splice site
            recognition
  JOURNAL   Elife 4, e04986 (2015)
   PUBMED   25555158
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1295)
  AUTHORS   Bai,B., Hales,C.M., Chen,P.C., Gozal,Y., Dammer,E.B., Fritz,J.J.,
            Wang,X., Xia,Q., Duong,D.M., Street,C., Cantero,G., Cheng,D.,
            Jones,D.R., Wu,Z., Li,Y., Diner,I., Heilman,C.J., Rees,H.D., Wu,H.,
            Lin,L., Szulwach,K.E., Gearing,M., Mufson,E.J., Bennett,D.A.,
            Montine,T.J., Seyfried,N.T., Wingo,T.S., Sun,Y.E., Jin,P.,
            Hanfelt,J., Willcock,D.M., Levey,A., Lah,J.J. and Peng,J.
  TITLE     U1 small nuclear ribonucleoprotein complex and RNA splicing
            alterations in Alzheimer's disease
  JOURNAL   Proc Natl Acad Sci U S A 110 (41), 16562-16567 (2013)
   PUBMED   24023061
REFERENCE   4  (bases 1 to 1295)
  AUTHORS   Pabis,M., Neufeld,N., Steiner,M.C., Bojic,T., Shav-Tal,Y. and
            Neugebauer,K.M.
  TITLE     The nuclear cap-binding complex interacts with the U4/U6.U5
            tri-snRNP and promotes spliceosome assembly in mammalian cells
  JOURNAL   RNA 19 (8), 1054-1063 (2013)
   PUBMED   23793891
REFERENCE   5  (bases 1 to 1295)
  AUTHORS   Zhang,L., Li,X. and Zhao,R.
  TITLE     Structural analyses of the pre-mRNA splicing machinery
  JOURNAL   Protein Sci 22 (6), 677-692 (2013)
   PUBMED   23592432
  REMARK    Review article
REFERENCE   6  (bases 1 to 1295)
  AUTHORS   Novakova,Z., Man,P., Novak,P., Hozak,P. and Hodny,Z.
  TITLE     Separation of nuclear protein complexes by blue native
            polyacrylamide gel electrophoresis
  JOURNAL   Electrophoresis 27 (7), 1277-1287 (2006)
   PUBMED   16502463
REFERENCE   7  (bases 1 to 1295)
  AUTHORS   Sinha,K., Perumal,K., Chen,Y. and Reddy,R.
  TITLE     Post-transcriptional adenylation of signal recognition particle RNA
            is carried out by an enzyme different from mRNA Poly(A) polymerase
  JOURNAL   J Biol Chem 274 (43), 30826-30831 (1999)
   PUBMED   10521474
REFERENCE   8  (bases 1 to 1295)
  AUTHORS   Neubauer,G., King,A., Rappsilber,J., Calvio,C., Watson,M., Ajuh,P.,
            Sleeman,J., Lamond,A. and Mann,M.
  TITLE     Mass spectrometry and EST-database searching allows
            characterization of the multi-protein spliceosome complex
  JOURNAL   Nat Genet 20 (1), 46-50 (1998)
   PUBMED   9731529
REFERENCE   9  (bases 1 to 1295)
  AUTHORS   Nagai,K., Oubridge,C., Jessen,T.H., Li,J. and Evans,P.R.
  TITLE     Crystal structure of the RNA-binding domain of the U1 small nuclear
            ribonucleoprotein A
  JOURNAL   Nature 348 (6301), 515-520 (1990)
   PUBMED   2147232
REFERENCE   10 (bases 1 to 1295)
  AUTHORS   Craft,J., Mimori,T., Olsen,T.L. and Hardin,J.A.
  TITLE     The U2 small nuclear ribonucleoprotein particle as an autoantigen.
            Analysis with sera from patients with overlap syndromes
  JOURNAL   J Clin Invest 81 (6), 1716-1724 (1988)
   PUBMED   2968364
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000001.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: FQ233559.1, FQ227089.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMN12840107,
                                           SAMN12840110 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-307               JAXUCZ010000001.1  91617449-91617755   c
            308-480             JAXUCZ010000001.1  91615046-91615218   c
            481-657             JAXUCZ010000001.1  91613872-91614048   c
            658-831             JAXUCZ010000001.1  91611727-91611900   c
            832-920             JAXUCZ010000001.1  91611264-91611352   c
            921-1295            JAXUCZ010000001.1  91609419-91609793   c
FEATURES             Location/Qualifiers
     source          1..1295
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q21"
     gene            1..1295
                     /gene="Snrpa"
                     /note="small nuclear ribonucleoprotein polypeptide A"
                     /db_xref="GeneID:292729"
                     /db_xref="RGD:1307416"
     exon            1..307
                     /gene="Snrpa"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    220..222
                     /gene="Snrpa"
                     /note="upstream in-frame stop codon"
     CDS             235..1080
                     /gene="Snrpa"
                     /codon_start=1
                     /product="U1 small nuclear ribonucleoprotein A"
                     /protein_id="NP_001425221.1"
                     /db_xref="GeneID:292729"
                     /db_xref="RGD:1307416"
                     /translation="
MAVPETRPNHTIYINNLNEKIKKDELKKSLYAIFSQFGQILDILVSRSLKMRGQAFVIFKEVSSATNALRSMQGFPFYDKPMRIQYAKTDSDIIAKMKGTFVERDRKREKRKPKSQETPAAKKAVQGGAAAPVVGAVQPVPGMPPMTQAPRIMHHMPGQPPYMPPPGMIPPPGLAPGQIPPGAMPPQQLMPGQMPPAQPLSENPPNHILFLTNLPEETNELMLSMLFNQFPGFKEVRLVPGRHDIAFVEFDNEVQAGAARDALQGFKITQNNAMKISFAKK"
     exon            308..480
                     /gene="Snrpa"
                     /inference="alignment:Splign:2.1.0"
     exon            481..657
                     /gene="Snrpa"
                     /inference="alignment:Splign:2.1.0"
     exon            658..831
                     /gene="Snrpa"
                     /inference="alignment:Splign:2.1.0"
     exon            832..920
                     /gene="Snrpa"
                     /inference="alignment:Splign:2.1.0"
     exon            921..1295
                     /gene="Snrpa"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ggattcgtagttaatctctagatcttccttaacacgcgggctggagacgcggagtcctaggctggctttgttgctaagtgtgccatcctcccccaattccggtcttactctactccctcctggaagaaagatccctgagcagagcccaccagtcctttagaacaaagaacttgggaaacgtaaggctaaatcgctttttcttcctccttaagcagtacctgaacatctcacaccatggcagttcccgagacccgtcccaaccacactatttatatcaacaatctcaatgagaagatcaagaaagatgagctcaagaagtccctgtatgccatcttctcccagtttggccagatcctggatatcctggtgtctcggagcctgaagatgaggggccaggccttcgtcatcttcaaggaggtcagcagtgccaccaacgccctgcgttccatgcagggcttccctttctacgacaagcccatgcgtatccagtacgcaaagactgactcagacatcattgccaaaatgaagggcacctttgtggagagagatcgcaaacgtgagaagaggaagcccaagagtcaggagacacctgctgccaaaaaggctgttcagggtggggcagctgcccctgtggttggcgctgtccagcctgtaccgggcatgccaccgatgactcaggcaccccgcatcatgcaccacatgccaggacagcctccctacatgccaccacctggcatgatcccgccaccaggccttgctcctggccagatccctcctggggcaatgcccccacagcagctcatgcctgggcagatgccacctgcccaacctctctcggagaatccacccaatcacatcctgttcctcaccaacctgcctgaggagaccaacgagctcatgctctccatgctcttcaaccagttccctggcttcaaggaggtgcgtctggtccctgggcgccatgacattgccttcgtggagtttgacaatgaagtgcaggctggggcagcacgagatgccctgcaaggcttcaagatcacacagaacaatgcaatgaagatctcttttgccaagaagtagcacctttccctacggagtgccccagtccccattctggggctgccccttccccctctcttggctcagtccctgaaggtaagtcccccttgggggccttctcagagccgtgagtgagtgtgtgtctgccacacagcattgtacccagggtcttcccagacattgcacctggcgctgttgggttgtgattaaagtgagtttttaggtttggtttttca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]