GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-03-12 04:20:23, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NM_001427140            2160 bp    mRNA    linear   ROD 03-APR-2024
DEFINITION  Rattus norvegicus RELB proto-oncogene, NF-kB subunit (Relb), mRNA.
ACCESSION   NM_001427140 XM_006228502
VERSION     NM_001427140.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2160)
  AUTHORS   Qiu,J., Yuan,H., Chen,S., Zhou,Y., Song,D. and Chen,R.
  TITLE     TNFalpha up-regulates COX-2 in chronic progressive nephropathy
            through nuclear accumulation of RelB and NF-kappaB2
  JOURNAL   Arch Physiol Biochem 122 (2), 88-93 (2016)
   PUBMED   26824492
  REMARK    GeneRIF: TNFalpha-RelB/p52 pathway may be involved in the early
            stages of renal damage, in part by stimulating COX-2 and
            inflammatory responses
REFERENCE   2  (bases 1 to 2160)
  AUTHORS   Sharfe,N., Merico,D., Karanxha,A., Macdonald,C., Dadi,H., Ngan,B.,
            Herbrick,J.A. and Roifman,C.M.
  TITLE     The effects of RelB deficiency on lymphocyte development and
            function
  JOURNAL   J Autoimmun 65, 90-100 (2015)
   PUBMED   26385063
REFERENCE   3  (bases 1 to 2160)
  AUTHORS   Li,Y., Xie,J., Xu,X., Liu,L., Wan,Y., Liu,Y., Zhu,C. and Zhu,Y.
  TITLE     Inducible interleukin 32 (IL-32) exerts extensive antiviral
            function via selective stimulation of interferon lambda1
            (IFN-lambda1)
  JOURNAL   J Biol Chem 288 (29), 20927-20941 (2013)
   PUBMED   23729669
REFERENCE   4  (bases 1 to 2160)
  AUTHORS   Vogel,K.U., Edelmann,S.L., Jeltsch,K.M., Bertossi,A., Heger,K.,
            Heinz,G.A., Zoller,J., Warth,S.C., Hoefig,K.P., Lohs,C., Neff,F.,
            Kremmer,E., Schick,J., Repsilber,D., Geerlof,A., Blum,H., Wurst,W.,
            Heikenwalder,M., Schmidt-Supprian,M. and Heissmeyer,V.
  TITLE     Roquin paralogs 1 and 2 redundantly repress the Icos and Ox40
            costimulator mRNAs and control follicular helper T cell
            differentiation
  JOURNAL   Immunity 38 (4), 655-668 (2013)
   PUBMED   23583643
REFERENCE   5  (bases 1 to 2160)
  AUTHORS   Xie,J., Wang,Y., Bao,J., Ma,Y., Zou,Z., Tang,Z., Dong,R. and Wen,H.
  TITLE     Immune tolerance induced by RelB short-hairpin RNA interference
            dendritic cells in liver transplantation
  JOURNAL   J Surg Res 180 (1), 169-175 (2013)
   PUBMED   23196258
REFERENCE   6  (bases 1 to 2160)
  AUTHORS   Bieg,S., Simonson,W., Ellefsen,K. and Lernmark,A.
  TITLE     Rel B is an early marker of autoimmune islet inflammation in the
            biobreeding (BB) rat
  JOURNAL   Pancreas 20 (1), 47-54 (2000)
   PUBMED   10630383
REFERENCE   7  (bases 1 to 2160)
  AUTHORS   Kurt,R.A., Urba,W.J., Smith,J.W. and Schoof,D.D.
  TITLE     Peripheral T lymphocytes from women with breast cancer exhibit
            abnormal protein expression of several signaling molecules
  JOURNAL   Int J Cancer 78 (1), 16-20 (1998)
   PUBMED   9724088
REFERENCE   8  (bases 1 to 2160)
  AUTHORS   Morrissey,J.J. and Klahr,S.
  TITLE     Rapid communication. Enalapril decreases nuclear factor kappa B
            activation in the kidney with ureteral obstruction
  JOURNAL   Kidney Int 52 (4), 926-933 (1997)
   PUBMED   9328931
REFERENCE   9  (bases 1 to 2160)
  AUTHORS   Burkly,L., Hession,C., Ogata,L., Reilly,C., Marconi,L.A., Olson,D.,
            Tizard,R., Cate,R. and Lo,D.
  TITLE     Expression of relB is required for the development of thymic
            medulla and dendritic cells
  JOURNAL   Nature 373 (6514), 531-536 (1995)
   PUBMED   7845467
REFERENCE   10 (bases 1 to 2160)
  AUTHORS   Dobrzanski,P., Ryseck,R.P. and Bravo,R.
  TITLE     Both N- and C-terminal domains of RelB are required for full
            transactivation: role of the N-terminal leucine zipper-like motif
  JOURNAL   Mol Cell Biol 13 (3), 1572-1582 (1993)
   PUBMED   8441398
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000001.1.
            
            On Jan 10, 2024 this sequence version replaced XM_006228502.4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR22582416.1146208.1,
                                           SRR21887623.631676.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA5760383,
                                           SAMEA5760386 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-211               JAXUCZ010000001.1  88413170-88413380   c
            212-262             JAXUCZ010000001.1  88412055-88412105   c
            263-591             JAXUCZ010000001.1  88401929-88402257   c
            592-749             JAXUCZ010000001.1  88399815-88399972   c
            750-841             JAXUCZ010000001.1  88398411-88398502   c
            842-973             JAXUCZ010000001.1  88397240-88397371   c
            974-1078            JAXUCZ010000001.1  88395204-88395308   c
            1079-1294           JAXUCZ010000001.1  88393727-88393942   c
            1295-1363           JAXUCZ010000001.1  88392988-88393056   c
            1364-1441           JAXUCZ010000001.1  88392794-88392871   c
            1442-2160           JAXUCZ010000001.1  88385717-88386435   c
FEATURES             Location/Qualifiers
     source          1..2160
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q21"
     gene            1..2160
                     /gene="Relb"
                     /note="RELB proto-oncogene, NF-kB subunit"
                     /db_xref="GeneID:100360982"
                     /db_xref="RGD:2321078"
     exon            1..211
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     CDS             160..1830
                     /gene="Relb"
                     /note="avian reticuloendotheliosis viral (v-rel) oncogene
                     related B; v-rel reticuloendotheliosis viral oncogene
                     homolog B; v-rel avian reticuloendotheliosis viral
                     oncogene homolog B"
                     /codon_start=1
                     /product="transcription factor RelB"
                     /protein_id="NP_001414069.1"
                     /db_xref="GeneID:100360982"
                     /db_xref="RGD:2321078"
                     /translation="
MPSRRAARESAPELGALGLRLPGSSDIPSLSRTTEIIDEYIKENGFGLDGAQLSEMPRLVPRGPASLSSVTLGPAAPPPPATPPWNCTLGRLVSPGPCPRPYLVITEQPKQRGMRFRYECEGRSAGSILGESSTEASKTLPAIELRDCGGLREVEVTACLVWKDWPHRVHPHSLVGKDCTDGVCRVRLRPHVSPRHSFNNLGIQCVRKKEIEAAIERKIQLGIDPYNAGSLKNHQEVDMNVVRICFQASYRDQQGHLHRMDPILSEPVYDKKSTNTSELRICRINKESGPCTGGEELYLLCDKVQKEDISVVFSTASWEGRADFSQADVHRQIAIVFKTPPYEDLEISEPVTVNVFLQRLTDGVCSEPLPFTYLPRDHDSYGVDKKRKRGLPDVLGELSSSDPHGIESKRRKKKPVFLDHFLPGHSSGLFLPPSALQSADTDFFPGTISLPGLEPPGGPDLLDDGFAYDPSAPTLFTMLDLLPPAPPLASAVVGNGGAGATVVESPGPEPLSLDSFAAPGPGDVGTASLVGSNMFPNQYREAAFGGGLLSPGPEAT"
     exon            212..262
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            263..591
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            592..749
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            750..841
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            842..973
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            974..1078
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            1079..1294
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            1295..1363
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            1364..1441
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
     exon            1442..2160
                     /gene="Relb"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gggcgccgtgcgtccaacccggccttcggccctatccttgcgcggcttccccggccggtgatcgtcccaacagactgggctgtccggctgcccggcttgccctcgtgcgcgcttcgccctgagcttgcctttgggctgtcggtccctacgggccgggccatgccgagtcgccgcgctgccagagagtccgcgcccgagctaggggccttgggtctccgtctcccaggttccagtgacatcccttcgctgtccaggaccacagaaatcatcgacgaatatattaaggagaacggcttcggcctggacggggcacagctgagtgagatgcctcgtctggtgccccgcgggccggcctcactgagcagcgtcactctgggcccagctgcaccaccgcctcctgccacgccgccctggaactgcacactgggcaggctggtatcacccggcccatgcccacggccatacttggtcatcacagagcagccaaagcagcgtggcatgcgcttccgctacgagtgcgagggtcgctcggctggcagcatcctcggggagagcagcactgaagccagcaagactctgcccgccatcgagcttcgagactgtggcgggctgcgggaggtggaggtgacggcgtgcctggtgtggaaggactggccacaccgggtacacccacacagccttgtggggaaagactgcacggacggcgtctgcagggtgcggctgcggcctcacgtcagcccccggcacagctttaacaacttgggcatccagtgtgttaggaagaaggaaatcgaagctgccattgagcgtaagatccagctgggaattgacccctacaatgctggctccctgaagaaccatcaggaggtcgacatgaatgttgtcaggatctgcttccaggcctcctatcgcgaccagcagggacatttgcaccgcatggaccccattctctctgagcctgtctacgacaagaagtccaccaacacctctgagctgcggatttgccgaatcaacaaggagagcgggccatgcacaggtggtgaggagctgtacttgctatgtgacaaggtgcaaaaagaggacatatccgtggtgttcagcacagcttcctgggaaggtcgtgctgacttttctcaagctgacgtgcacaggcagatcgccattgtgttcaaaacgccaccatacgaggacctggagatctcagagcccgtgacggtcaacgtgttcttgcagcggctcacagacggggtctgcagcgagccgctgcccttcacgtacttgcctcgggaccatgacagctatggtgtggacaagaagcgaaagcggggactgcctgatgtccttggagagctgagcagctctgatccacatggaattgaaagcaagcgacggaaaaagaaaccagtgttcttggaccacttcctgcctggccacagctccggcttgttcctgccgccatcggctctgcagtcagcagacactgatttcttccctggtaccatatcccttcctgggttggagcctcctggcggccctgacctcctggatgatggctttgcctacgatccctctgccccaacgctcttcactatgttggacctgctgcccccagcaccaccacttgccagtgctgtggtgggtaatgggggtgcaggggccacggtcgtggagtctcctggcccagagcccctgtcgctggactcttttgcagctccgggccctggggatgttggtactgctagccttgtgggcagcaacatgttccctaaccagtaccgagaggcagccttcgggggtggcctcctgtccccagggcctgaagccacgtagcctctgagttgaccaggaggcagtgggtgaggcttgtggtccagcactccatccccgaagccaaccttgatcagtcttccagcttcctcatcctgagtcggacgtctgcagtgctgttgagatggggtgagcgcctgttctctttgagcccattaaacagaatgcggagtccggagaggaaaaggggctcctgcaggtggaccccttctcaggacagaatctcaagattgtacataggggatagggagcagatccccagtcttcttccccaatcctgaagaagggggtaggttgtttgttcagttttcccaataaaaattagttttttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]