2025-04-20 10:48:11, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001277243 765 bp mRNA linear ROD 30-MAR-2024 DEFINITION Rattus norvegicus ribosomal protein S5 (Rps5), transcript variant 1, mRNA. ACCESSION NM_001277243 VERSION NM_001277243.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 765) AUTHORS Xu,W.H., Hu,H.G., Tian,Y., Wang,S.Z., Li,J., Li,J.Z., Deng,X., Qian,H., Qiu,L., Hu,Z.L., Wu,Q.Y., Chai,Y.F., Guo,C., Xie,W.F. and Zhang,J.P. TITLE Bioactive compound reveals a novel function for ribosomal protein S5 in hepatic stellate cell activation and hepatic fibrosis JOURNAL Hepatology 60 (2), 648-660 (2014) PUBMED 24668691 REMARK GeneRIF: These results demonstrate that RPS5 is implicated in hepatic fibrogenesis. REFERENCE 2 (bases 1 to 765) AUTHORS Zanivan,S., Maione,F., Hein,M.Y., Hernandez-Fernaud,J.R., Ostasiewicz,P., Giraudo,E. and Mann,M. TITLE SILAC-based proteomics of human primary endothelial cell morphogenesis unveils tumor angiogenic markers JOURNAL Mol Cell Proteomics 12 (12), 3599-3611 (2013) PUBMED 23979707 REFERENCE 3 (bases 1 to 765) AUTHORS Anger,A.M., Armache,J.P., Berninghausen,O., Habeck,M., Subklewe,M., Wilson,D.N. and Beckmann,R. TITLE Structures of the human and Drosophila 80S ribosome JOURNAL Nature 497 (7447), 80-85 (2013) PUBMED 23636399 REFERENCE 4 (bases 1 to 765) AUTHORS Baltz,A.G., Munschauer,M., Schwanhausser,B., Vasile,A., Murakawa,Y., Schueler,M., Youngs,N., Penfold-Brown,D., Drew,K., Milek,M., Wyler,E., Bonneau,R., Selbach,M., Dieterich,C. and Landthaler,M. TITLE The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts JOURNAL Mol Cell 46 (5), 674-690 (2012) PUBMED 22681889 REFERENCE 5 (bases 1 to 765) AUTHORS Castello,A., Fischer,B., Eichelbaum,K., Horos,R., Beckmann,B.M., Strein,C., Davey,N.E., Humphreys,D.T., Preiss,T., Steinmetz,L.M., Krijgsveld,J. and Hentze,M.W. TITLE Insights into RNA biology from an atlas of mammalian mRNA-binding proteins JOURNAL Cell 149 (6), 1393-1406 (2012) PUBMED 22658674 REFERENCE 6 (bases 1 to 765) AUTHORS Vladimirov,S.N., Ivanov,A.V., Karpova,G.G., Musolyamov,A.K., Egorov,T.A., Thiede,B., Wittmann-Liebold,B. and Otto,A. TITLE Characterization of the human small-ribosomal-subunit proteins by N-terminal and internal sequencing, and mass spectrometry JOURNAL Eur J Biochem 239 (1), 144-149 (1996) PUBMED 8706699 REFERENCE 7 (bases 1 to 765) AUTHORS Kuwano,Y., Olvera,J. and Wool,I.G. TITLE The primary structure of rat ribosomal protein S5. A ribosomal protein present in the rat genome in a single copy JOURNAL J Biol Chem 267 (35), 25304-25308 (1992) PUBMED 1460027 REFERENCE 8 (bases 1 to 765) AUTHORS Lutsch,G., Bielka,H., Enzmann,G. and Noll,F. TITLE Electron microscopic investigations on the location of rat liver ribosomal proteins S3a, S5, S6, S7 and S9 by means of antibody labeling JOURNAL Biomed Biochim Acta 42 (6), 705-723 (1983) PUBMED 6196023 REFERENCE 9 (bases 1 to 765) AUTHORS Collatz,E., Ulbrich,N., Tsurugi,K., Lightfoot,H.N., MacKinlay,W., Lin,A. and Wool,I.G. TITLE Isolation of eukaryotic ribosomal proteins. Purification and characterization of the 40 S ribosomal subunit proteins Sa, Sc, S3a, S3b, S5', S9, S10, S11, S12, S14, S15, S15', S16, S17, S18, S19, S20, S21, S26, S27', and S29 JOURNAL J Biol Chem 252 (24), 9071-9080 (1977) PUBMED 925037 REFERENCE 10 (bases 1 to 765) AUTHORS Collatz,E., Wool,I.G., Lin,A. and Stoffler,G. TITLE The isolation of eukaryotic ribosomal proteins. The purification and characterization of the 40 S ribosomal subunit proteins S2, S3, S4, S5, S6, S7, S8, S9, S13, S23/S24, S27, and S28 JOURNAL J Biol Chem 251 (15), 4666-4672 (1976) PUBMED 947902 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000001.1 and FM052146.1. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: CF111089.1, FQ145126.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760383, SAMEA5760386 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-44 JAXUCZ010000001.1 82610965-82611008 45-673 FM052146.1 1-629 674-765 JAXUCZ010000001.1 82615171-82615262 FEATURES Location/Qualifiers source 1..765 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="1" /map="1q21" gene 1..765 /gene="Rps5" /note="ribosomal protein S5" /db_xref="GeneID:25538" /db_xref="RGD:3601" exon 1..97 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 98..206 /gene="Rps5" /inference="alignment:Splign:2.1.0" CDS 99..713 /gene="Rps5" /note="isoform 1 is encoded by transcript variant 1; 40S ribosomal protein S5; small ribosomal subunit protein uS7" /codon_start=1 /product="small ribosomal subunit protein uS7 isoform 1" /protein_id="NP_001264172.1" /db_xref="GeneID:25538" /db_xref="RGD:3601" /translation="
MTEWETATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSSNSYAIKKKDELERVAKSNR"
misc_feature 99..101 /gene="Rps5" /note="N-acetylmethionine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P24050.3); acetylation site" misc_feature 102..104 /gene="Rps5" /note="N-acetylthreonine, in 40S ribosomal protein S5, N-terminally processed. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P24050.3); acetylation site" misc_feature 138..140 /gene="Rps5" /note="Phosphothreonine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P24050.3); phosphorylation site" misc_feature 150..710 /gene="Rps5" /note="Eukaryota homolog of Ribosomal Protein S7; Region: uS7_Eukaryote; cd14867" /db_xref="CDD:271246" misc_feature order(150..152,237..245,249..260,357..359,369..371) /gene="Rps5" /note="S9 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature 237..239 /gene="Rps5" /note="N6-acetyllysine, alternate. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P24050.3); acetylation site" misc_feature order(249..251,255..257,267..278,285..287,309..311, 318..320,324..338,348..362,369..371,489..497,501..503, 531..533,552..554,573..575,582..584,600..605) /gene="Rps5" /note="rRNA binding site [nucleotide binding]; other site" /db_xref="CDD:271246" misc_feature order(381..383,390..395,402..404,600..602,606..611) /gene="Rps5" /note="S25 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature order(486..488,495..497,501..503,708..710) /gene="Rps5" /note="S11 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature 522..524 /gene="Rps5" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P24050.3); phosphorylation site" exon 207..416 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 417..545 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 546..644 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 645..765 /gene="Rps5" /inference="alignment:Splign:2.1.0" ORIGIN
aaaagcgctggcctgctacgttcggcctcttcctgtctgtgccagaactgcgcgtggtccgcgccgatcgactgagaagcccggtttgcgctctcagaatgactgaatgggaaacagccacacccgcggtggcagagaccccggacatcaagctctttgggaaatggagcactgatgatgtgcagatcaacgatatttctctacaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgcaggacggtatgctgccaagcgtttccgcaaagcacagtgtcccatcgtggagcgccttactaactccatgatgatgcacggtcgtaacaacggcaagaagctcatgactgtacgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggctggaacagtgagacggcaggctgtggatgtatccccacttcgccgagtgaatcaggccatctggctgctgtgcacgggggctcgtgaggctgctttccggaacatcaagaccatcgctgagtgccttgcagatgagctcattaatgctgccaagggctcctccaactcctatgctatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaattgtgtgccctttgggacagttacatctt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]