GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-23 11:37:13, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       XM_015780696             914 bp    mRNA    linear   PLN 10-JUL-2024
DEFINITION  PREDICTED: Oryza sativa Japonica Group psbQ-like protein 3,
            chloroplastic (LOC4336434), mRNA.
ACCESSION   XM_015780696
VERSION     XM_015780696.3
DBLINK      BioProject: PRJNA1123306
KEYWORDS    RefSeq.
SOURCE      Oryza sativa Japonica Group (Japanese rice)
  ORGANISM  Oryza sativa Japonica Group
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_089038) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 10, 2024 this sequence version replaced XM_015780696.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_034140825.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/21/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..914
                     /organism="Oryza sativa Japonica Group"
                     /mol_type="mRNA"
                     /db_xref="taxon:39947"
                     /chromosome="4"
     gene            1..914
                     /gene="LOC4336434"
                     /note="psbQ-like protein 3, chloroplastic; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 3 ESTs, 208 long SRA reads, 4 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 125 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:4336434"
     CDS             138..695
                     /gene="LOC4336434"
                     /codon_start=1
                     /product="psbQ-like protein 3, chloroplastic"
                     /protein_id="XP_015636182.1"
                     /db_xref="GeneID:4336434"
                     /translation="
MALQLAAQALSAILLSGAQPSSRRATPPGNGQRSRRPPATGRRRLAASLLASQLLLLPAAATSVAGAFEFDLRITVPEQSGEEAEAVVKLHARNLVRVKGLIDARSWRELQAALRSSAANLKQDLYAIIQASPASRRPELRRLYSDLFNSVTSLDYAARDKDELRVQEYYSNMITSLDEIFSKIM"
     misc_feature    138..689
                     /gene="LOC4336434"
                     /note="PSII-Q subunit; Region: PLN02956"
                     /db_xref="CDD:215515"
     polyA_site      914
                     /gene="LOC4336434"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
tacacatgcccgtgttggctttggggtttcccgactgaatgtgtcaagtgtcaacgtgacaccaaccttatcggaagcacctggctgtgcacgcctcagcgtccaagaaggctacacgctgccactgccaatctgccatggcattgcagctcgctgcccaagcgctctccgcgatcctcctgtccggcgcccagccgagcagcagacgcgcgacaccgcccggaaacggccaacggagtcggagaccgccagccaccggcaggcggcggctggcggcgtcgctcctcgcgtcccagctgctgctgctgcccgcggcggcgaccagcgtcgccggcgcgttcgagttcgacctgaggatcactgtgccggagcagtccggcgaggaggccgaggccgtcgtgaagctccacgcgaggaacctggtgcgcgtcaaggggctcatcgacgccaggtcgtggagggagctgcaggcggcgctccggtccagcgccgccaacctcaagcaggacctctacgccatcatccaggcgagcccggcgagccggcggccggagctccggcggctctactccgacctcttcaacagcgtcaccagcctagattatgcggccagggacaaggatgagctccgagttcaggaatactacagcaacatgatcacaagcctcgacgagattttttccaagatcatgtagcagctgtcgatttttagctcgtctaggatgaatagagagagagagagagagagagagagagagatgaattagataaagctagactcttggattgcattttacacacagggaacagcaaaatgttaacgggcaaaaaggccttttttttcctcttttgctaagcttagctaatagctagctagctagctagtacttattattaactaacttcctattcta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]