2024-09-29 10:22:50, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS XM_015775752 2033 bp mRNA linear PLN 07-AUG-2018 DEFINITION PREDICTED: Oryza sativa Japonica Group cystathionine gamma-synthase 1, chloroplastic (LOC4332956), mRNA. ACCESSION XM_015775752 VERSION XM_015775752.2 DBLINK BioProject: PRJNA122 KEYWORDS RefSeq; corrected model. SOURCE Oryza sativa Japonica Group (Japanese rice) ORGANISM Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa. REFERENCE 1 AUTHORS Ominato,K., Akita,H., Suzuki,A., Kijima,F., Yoshino,T., Yoshino,M., Chiba,Y., Onouchi,H. and Naito,S. TITLE Identification of a short highly conserved amino acid sequence as the functional region required for posttranscriptional autoregulation of the cystathionine gamma-synthase gene in Arabidopsis JOURNAL J. Biol. Chem. 277 (39), 36380-36386 (2002) PUBMED 12121993 COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_029258.1) and transcript sequence (AB246893.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Aug 7, 2018 this sequence version replaced XM_015775752.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Oryza sativa Japonica Group Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## assembly gap :: added 81 transcript bases to patch genome assembly gap ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-264 AP014959.1 14854285-14854548 c 265-345 AB246893.1 211-291 346-457 AP014959.1 14853668-14853779 c 458-561 AP014959.1 14853468-14853571 c 562-635 AP014959.1 14853282-14853355 c 636-804 AP014959.1 14852978-14853146 c 805-864 AP014959.1 14852311-14852370 c 865-1068 AP014959.1 14852017-14852220 c 1069-1155 AP014959.1 14851856-14851942 c 1156-1263 AP014959.1 14851487-14851594 c 1264-1359 AP014959.1 14851288-14851383 c 1360-1478 AP014959.1 14851087-14851205 c 1479-2033 AP014959.1 14850451-14851005 c FEATURES Location/Qualifiers source 1..2033 /organism="Oryza sativa Japonica Group" /mol_type="mRNA" /cultivar="Nipponbare" /db_xref="taxon:39947" /chromosome="3" gene 1..2033 /gene="LOC4332956" /note="The sequence of the model RefSeq transcript was modified relative to its source genomic sequence to represent the inferred CDS: added 81 bases not found in genome assembly; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 mRNAs, 51 ESTs, 21 Proteins, and 98% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:4332956" CDS 55..1599 /gene="LOC4332956" /note="The sequence of the model RefSeq protein was modified relative to its source genomic sequence to represent the inferred CDS: added 81 bases not found in genome assembly" /codon_start=1 /product="cystathionine gamma-synthase 1, chloroplastic" /protein_id="XP_015631238.1" /db_xref="GeneID:4332956" /translation="
MATVSSLPSPAFLAADPAAALPSATILRFPPNFVRQLSTKARRNCSNIGVAQIVAAAWSDPARPASLPGGGAGGRRGASSRAAATPAAAAAASAAAEATAEVGAIPNAKLGQPSAAALAEQALLGSDASLAVHAGERLGRRIATDAITTPVVNTSAYWFNNSQELIDFKEGRHASFEYGRYGNPTTEALEKKMSALEKAESTVFVASGMYASVAMLSALVPAGGHVVTTTDCYRKTRIYMETELPKRGITMTVIRPADMDALQNALDNNNVSLFFTETPTNPFLRCIDIDLVSKMCHSKGALLCIDSTFASPINQKALTLGADLVIHSATKYIAGHNDVIGGCISGRDELVSKVRIYHHVVGGVLNPNAAYLILRGMKTLHLRVQCQNNTAMRMAQFLEEHPKIARVYYPGLPSHPEHHIAKSQMTGFGGVISFEVAGDFDATRRFIDSVKIPYHAPSFGGCESIIDQPAIMSYWDSKEQREIYGIKDNLIRFSIGVEDFEDLKNDVVQALDKI"
misc_feature 487..1590 /gene="LOC4332956" /note="Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of antimicrobials and...; Region: CGS_like; cd00614" /db_xref="CDD:99738" misc_feature order(511..522,526..531,586..588,592..594,670..675, 679..684,751..753,766..768,775..777,1042..1044,1066..1068, 1072..1074,1120..1122,1150..1152,1156..1161,1396..1398) /gene="LOC4332956" /note="homodimer interface [polypeptide binding]; other site" /db_xref="CDD:99738" misc_feature order(673..681,751..753,883..885,970..972,1036..1038, 1042..1047,1072..1074) /gene="LOC4332956" /note="substrate-cofactor binding pocket [active]" /db_xref="CDD:99738" misc_feature order(673..681,751..753,970..972,979..981,1036..1038, 1042..1047) /gene="LOC4332956" /note="pyridoxal 5'-phosphate binding site [chemical binding]; other site" /db_xref="CDD:99738" misc_feature 1045..1047 /gene="LOC4332956" /note="catalytic residue [active]" /db_xref="CDD:99738" ORIGIN
ccgcgacccgccgcgccgcccgcccaaaccctagccctcctcctcctcctcgccatggccaccgtctcctccctcccgtccccggcgttcctggccgccgacccggccgccgcgctcccctccgccaccatcctccgcttcccgccaaacttcgtccgccagctcagcaccaaggcccgccgcaactgcagcaacatcggcgtcgcgcagatcgtcgccgccgcctggtccgaccccgcgcgccccgcctccctccccggcggcggcgccggcggccgtcgcggcgcctcctcccgcgccgccgccacgcccgccgccgccgccgccgcctccgcggcggcggaggccacggccgaggttggcgccatccccaacgccaagctcggccagccgtccgccgccgcattggccgagcaggccctgctcggttcagacgccagcctcgccgtccacgcgggcgagaggctgggcagaaggatcgccacagacgcgatcaccacgccagtagtgaacacctcggcctactggttcaacaactcgcaggagctcattgacttcaaggaggggaggcatgctagcttcgagtatgggaggtatggtaacccgaccactgaggcattggagaagaagatgagtgcactggagaaagccgagtccactgtctttgtggcatccgggatgtatgcaagtgtggctatgctcagcgcgcttgttccagcaggtgggcacgttgtgaccaccactgattgttaccgcaagacgagaatttacatggagactgaactacctaagaggggaattacgatgaccgttattagacctgctgacatggatgctctccaaaatgcactggataataataatgtatccctattcttcaccgagactcctactaatccatttctgagatgcatcgacattgatcttgtctcaaaaatgtgccatagcaagggagcattgctttgtattgatagtacctttgcatccccaatcaatcagaaggcactaactctaggtgctgacttagttatccattcagcaacaaagtacattgctgggcacaatgatgttattggaggctgcatcagtggcagagatgagctagtttccaaagtccgcatctatcaccatgtagttggtggtgttctaaatccgaatgctgcctacttgattcttcgaggcatgaagacactgcatctccgtgtacaatgtcagaataatactgcaatgcggatggcccaatttttagaggaacatccaaagattgcacgtgtctactatcctggtctgccaagtcacccagaacatcacattgccaagagtcagatgaccggctttggtggtgtcattagttttgaggttgctggagactttgatgctactaggagatttattgattctgttaagataccctatcatgccccatcatttgggggctgtgagagcattattgatcagcctgccatcatgtcttactgggattcaaaggagcagagagaaatctatggaatcaaggacaacttgatcaggttcagcattggagtggaggattttgaggatttgaagaatgacgttgttcaggcgcttgacaagatctaagcacctgattgcatcctcatcatgagagttcatctatctgatcttgtttgcctctgcatcacgtggagaactttgatattccagctgagaattgcgaataagtttcttcattagttcccattatctagtctttagttccaattaagtttgtgtctctgttttttcctctcaaaatggctatgttcagaattatttttgaaatgctgaaaatccaccgttgtgttgtgtacttttgcttgcctgttgtcctgttggtagtcggaacagagaagttgctttgcataccgttgggatgcattataccagtagttttattacggtttgagccttgctattgctgacatagatcactatgggtatgggatgtatggattcaatgagaacaaagcccaatctccattgcaagggtgaaaggatgctggggcttgatatca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]