LOCUS       XM_015764786             925 bp    mRNA    linear   PLN 10-JUL-2024
DEFINITION  PREDICTED: Oryza sativa Japonica Group auxin-binding protein 4
            (LOC4352396), mRNA.
ACCESSION   XM_015764786
VERSION     XM_015764786.3
DBLINK      BioProject: PRJNA1123306
KEYWORDS    RefSeq.
SOURCE      Oryza sativa Japonica Group (Japanese rice)
  ORGANISM  Oryza sativa Japonica Group
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_089046) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 10, 2024 this sequence version replaced XM_015764786.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_034140825.1-RS_2024_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/21/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..925
                     /organism="Oryza sativa Japonica Group"
                     /mol_type="mRNA"
                     /db_xref="taxon:39947"
                     /chromosome="12"
     gene            1..925
                     /gene="LOC4352396"
                     /note="auxin-binding protein 4; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 4
                     mRNAs, 4 ESTs, 466 long SRA reads, 35 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 126 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:4352396"
     misc_feature    1
                     /gene="LOC4352396"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             41..661
                     /gene="LOC4352396"
                     /codon_start=1
                     /product="auxin-binding protein 4"
                     /protein_id="XP_015620272.1"
                     /db_xref="GeneID:4352396"
                     /translation="

METRTGPTAAGGHGAHLAGAGRGALLLALVVVSAAAFLPVAESSCPRDNSLVKDVSKMYQSNYGREGFSHITIAGALAHGMKEVEVWLQTFGPGQRTPIHRHSCEEVFVVLKGKGTLLLGSSSMKYPGQPQEIPVFQNSTFSVPVNDPHQVWNSDEHEDLQVLVIISRPPVKIFTYDDWSVPHTAAKLKFPYFWDEDCLPAPKDEL"

     misc_feature    188..640
                     /gene="LOC4352396"
                     /note="auxin-binding protein 1, cupin domain; Region:
                     cupin_ABP1; cd02220"
                     /db_xref="CDD:380349"
     misc_feature    order(191..205,257..259,281..292,296..298,353..355,
                     359..361,365..367,389..391,395..397,437..439,443..448,
                     452..466,527..529,533..535,539..544)
                     /gene="LOC4352396"
                     /note="homodimer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:380349"
     misc_feature    order(242..244,299..301,305..307,329..334,338..340,
                     344..346,356..358,362..364,485..487,620..622)
                     /gene="LOC4352396"
                     /note="active site"
                     /db_xref="CDD:380349"
     polyA_site      925
                     /gene="LOC4352396"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

actgcatttctcagttttcgagaggtctagaagaaaagagatggagactagaactggaccaactgccgccggcggccatggcgcccacctcgccggcgccggccgcggcgccctcctcctcgcgctcgtcgtcgtctctgccgccgccttcctccccgtagccgaatcgtcctgcccgcgagacaattcgcttgtgaaagatgttagcaaaatgtaccaaagcaactatggaagggaagggttctcacatataaccattgctggtgccctagctcatggaatgaaggaggtggaagtgtggcttcagacatttggaccagggcaaaggacgccgatccacaggcactcgtgcgaggaagtttttgtcgtcttgaaagggaaagggacactcttgctggggtcaagctcaatgaagtatccagggcagcctcaggagattcccgtctttcagaatagcacattctctgttcctgtaaatgatccgcaccaggtttggaattctgatgaacatgaggatttgcaggtgcttgtgatcatttcgcgcccacctgtcaagatatttacatatgacgattggagtgtgcctcatacagcagcaaaactgaagttcccctacttctgggatgaggactgcttaccagcaccgaaggatgaactctagtttctaaaccggctattgcagtgtatcatcttcattcaagatactgctggattgcggtcgatacttgctgtaactcttttcccttctctctaatgtgcagttctaaaatgtgttctcttgcttaatgtcaggacttatgtacttagagcttttgcagtaaggaccactgtaagtgtaaactagttacataataacgcttcactaatccagacattatctgtgtatataaataaatgcctacacagctggtttcttgttgattaa

//