GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-23 05:45:15, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_033552               1509 bp    RNA     linear   ROD 26-SEP-2023
DEFINITION  Mus musculus zinc finger E-box binding homeobox 1, opposite strand
            1 (Zeb1os1), long non-coding RNA.
ACCESSION   NR_033552
VERSION     NR_033552.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1509)
  AUTHORS   Kurima K, Hertzano R, Gavrilova O, Monahan K, Shpargel KB, Nadaraja
            G, Kawashima Y, Lee KY, Ito T, Higashi Y, Eisenman DJ, Strome SE
            and Griffith AJ.
  TITLE     A noncoding point mutation of Zeb1 causes multiple developmental
            malformations and obesity in Twirler mice
  JOURNAL   PLoS Genet 7 (9), e1002307 (2011)
   PUBMED   21980308
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC127028.18 and AC121576.2.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK134789.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMN00849374,
                                           SAMN00849375 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-278               AC127028.18        64326-64603         c
            279-362             AC127028.18        55879-55962         c
            363-484             AC127028.18        55178-55299         c
            485-557             AC121576.2         130986-131058       c
            558-733             AC121576.2         115594-115769       c
            734-912             AC121576.2         110971-111149       c
            913-1509            AC121576.2         81881-82477         c
FEATURES             Location/Qualifiers
     source          1..1509
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="18"
                     /map="18 3.71 cM"
     gene            1..1509
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /note="zinc finger E-box binding homeobox 1, opposite
                     strand 1"
                     /db_xref="GeneID:791318"
                     /db_xref="MGI:MGI:3642044"
     ncRNA           1..1509
                     /ncRNA_class="lncRNA"
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /product="zinc finger E-box binding homeobox 1, opposite
                     strand 1"
                     /db_xref="GeneID:791318"
                     /db_xref="MGI:MGI:3642044"
     exon            1..278
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /inference="alignment:Splign:2.1.0"
     exon            279..362
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /inference="alignment:Splign:2.1.0"
     exon            363..484
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /inference="alignment:Splign:2.1.0"
     exon            485..557
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /inference="alignment:Splign:2.1.0"
     exon            558..733
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /inference="alignment:Splign:2.1.0"
     exon            734..912
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /inference="alignment:Splign:2.1.0"
     exon            913..1509
                     /gene="Zeb1os1"
                     /gene_synonym="Gm10125; Zeb1os"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agccgacacgcaaccagcccgcggccgcccgtcctctcccgcccgcgcccgccccgcagcccgcgcccgcccgccgcaagtttgttccccgccgctgcggcctgcgcggagagaggatcgcgcgcggggaggcgccgaggggcagcaagagtggagaaagtgcggaaagaagcaacagccgctccacccgcgggcggaaaagtggccgggcgcggcggcgggatgcggcgcagctaacggtccccggcggccgccggagccgctaggcgcagaggcaggctggcacctgtgcagtgggagagagttcttgtcactggtgactcatcgtgcagggagcacaaggaagagcaaggggatagtgtctcacaagtgtagggctggagctacaggaaccatccaggtgcactggcttggcctctgcatctttctgtgccactgtctcattctgtttccggctgtgcgtggatgcggatggcccagagagcatggaaggggaataaactggactggacttcctgtccaccctctacaactaacaaggacctttggtgatctcgttccaggtggtgtgaacttctcctgggactgtccctcccagcagctccagagccacactgccttggaagacccgacagacagattgctccaccttgacccttctttccacagtgtcttcagcatctctgtccctcccattcccactccatttcttctatctctccccatgcaagagtggatcagctgcatcctgggccagtagggtcctttgcaggtggccaaccaagagaaagaggaagtggctcttggaatcacagacccaggctgggaagaatttgtgtgatgcagtggccaccccctaagagctgcagtgatcctctctgagcccttcagaaagcactatgaccacaaaaagttctcaaggggcagcagccatttcccatagacaggctgtgtcatgtccacattcaccacagggcaattatggtggagaagaaaaagaaactggaccggatgaactgttaataaaccttctttgacaagccacctccatggtggctaagatttctgcagcttcacatatctatatagacctgcttcaccttaaaatgtggcgcactatgaatgtgtctgttttactactgttggcatggagtgctggttttctctggcatgtaaatcagaagttgtgactctgggaaccttctttccctgccatgccaggctatgcagctggagggtgcaaaggagaggcctttgttcagggtttctgggaccagtctcctgactttcttcttgtctgtcagccccagatgctatcctaaacaacagctcttccttgtgtctagctagagaaagattttcttcggtatcatctttaggtatcattctaaaataaaatctttgtctaaggtaattgtgcaagggttttccaggaagcaatagttaaggaatgattgctagaaatgttttagttaattgaatattctggaaaataaatgtgacattatc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]