ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-23 05:45:15, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_033552 1509 bp RNA linear ROD 26-SEP-2023 DEFINITION Mus musculus zinc finger E-box binding homeobox 1, opposite strand 1 (Zeb1os1), long non-coding RNA. ACCESSION NR_033552 VERSION NR_033552.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1509) AUTHORS Kurima K, Hertzano R, Gavrilova O, Monahan K, Shpargel KB, Nadaraja G, Kawashima Y, Lee KY, Ito T, Higashi Y, Eisenman DJ, Strome SE and Griffith AJ. TITLE A noncoding point mutation of Zeb1 causes multiple developmental malformations and obesity in Twirler mice JOURNAL PLoS Genet 7 (9), e1002307 (2011) PUBMED 21980308 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC127028.18 and AC121576.2. Sequence Note: The RefSeq transcript was derived from the reference genome assembly. The genomic coordinates were determined from transcript alignments. ##Evidence-Data-START## Transcript exon combination :: AK134789.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMN00849374, SAMN00849375 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-278 AC127028.18 64326-64603 c 279-362 AC127028.18 55879-55962 c 363-484 AC127028.18 55178-55299 c 485-557 AC121576.2 130986-131058 c 558-733 AC121576.2 115594-115769 c 734-912 AC121576.2 110971-111149 c 913-1509 AC121576.2 81881-82477 c FEATURES Location/Qualifiers source 1..1509 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="18" /map="18 3.71 cM" gene 1..1509 /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /note="zinc finger E-box binding homeobox 1, opposite strand 1" /db_xref="GeneID:791318" /db_xref="MGI:MGI:3642044" ncRNA 1..1509 /ncRNA_class="lncRNA" /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /product="zinc finger E-box binding homeobox 1, opposite strand 1" /db_xref="GeneID:791318" /db_xref="MGI:MGI:3642044" exon 1..278 /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /inference="alignment:Splign:2.1.0" exon 279..362 /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /inference="alignment:Splign:2.1.0" exon 363..484 /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /inference="alignment:Splign:2.1.0" exon 485..557 /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /inference="alignment:Splign:2.1.0" exon 558..733 /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /inference="alignment:Splign:2.1.0" exon 734..912 /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /inference="alignment:Splign:2.1.0" exon 913..1509 /gene="Zeb1os1" /gene_synonym="Gm10125; Zeb1os" /inference="alignment:Splign:2.1.0" ORIGIN
agccgacacgcaaccagcccgcggccgcccgtcctctcccgcccgcgcccgccccgcagcccgcgcccgcccgccgcaagtttgttccccgccgctgcggcctgcgcggagagaggatcgcgcgcggggaggcgccgaggggcagcaagagtggagaaagtgcggaaagaagcaacagccgctccacccgcgggcggaaaagtggccgggcgcggcggcgggatgcggcgcagctaacggtccccggcggccgccggagccgctaggcgcagaggcaggctggcacctgtgcagtgggagagagttcttgtcactggtgactcatcgtgcagggagcacaaggaagagcaaggggatagtgtctcacaagtgtagggctggagctacaggaaccatccaggtgcactggcttggcctctgcatctttctgtgccactgtctcattctgtttccggctgtgcgtggatgcggatggcccagagagcatggaaggggaataaactggactggacttcctgtccaccctctacaactaacaaggacctttggtgatctcgttccaggtggtgtgaacttctcctgggactgtccctcccagcagctccagagccacactgccttggaagacccgacagacagattgctccaccttgacccttctttccacagtgtcttcagcatctctgtccctcccattcccactccatttcttctatctctccccatgcaagagtggatcagctgcatcctgggccagtagggtcctttgcaggtggccaaccaagagaaagaggaagtggctcttggaatcacagacccaggctgggaagaatttgtgtgatgcagtggccaccccctaagagctgcagtgatcctctctgagcccttcagaaagcactatgaccacaaaaagttctcaaggggcagcagccatttcccatagacaggctgtgtcatgtccacattcaccacagggcaattatggtggagaagaaaaagaaactggaccggatgaactgttaataaaccttctttgacaagccacctccatggtggctaagatttctgcagcttcacatatctatatagacctgcttcaccttaaaatgtggcgcactatgaatgtgtctgttttactactgttggcatggagtgctggttttctctggcatgtaaatcagaagttgtgactctgggaaccttctttccctgccatgccaggctatgcagctggagggtgcaaaggagaggcctttgttcagggtttctgggaccagtctcctgactttcttcttgtctgtcagccccagatgctatcctaaacaacagctcttccttgtgtctagctagagaaagattttcttcggtatcatctttaggtatcattctaaaataaaatctttgtctaaggtaattgtgcaagggttttccaggaagcaatagttaaggaatgattgctagaaatgttttagttaattgaatattctggaaaataaatgtgacattatc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]