GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-05 18:44:05, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NR_029821                 89 bp    RNA     linear   ROD 01-OCT-2024
DEFINITION  Mus musculus microRNA 181c (Mir181c), microRNA.
ACCESSION   NR_029821
VERSION     NR_029821.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 89)
  AUTHORS   Quiroga,D., Roman,B., Salih,M., Daccarett-Bojanini,W.N., Garbus,H.,
            Ebenebe,O.V., Dodd-O,J.M., O'Rourke,B., Kohr,M. and Das,S.
  TITLE     Sex-dependent phosphorylation of Argonaute 2 reduces the
            mitochondrial translocation of miR-181c and induces
            cardioprotection in females
  JOURNAL   J Mol Cell Cardiol 194, 59-69 (2024)
   PUBMED   38880194
  REMARK    GeneRIF: Sex-dependent phosphorylation of Argonaute 2 reduces the
            mitochondrial translocation of miR-181c and induces
            cardioprotection in females.
REFERENCE   2  (bases 1 to 89)
  AUTHORS   Li,R., Yao,S., Wei,F., Chen,M., Zhong,Y., Zou,C., Chen,L., Wei,L.,
            Yang,C., Zhang,X. and Liu,Y.
  TITLE     Downregulation of miR-181c-5p in Alzheimer's disease weakens the
            response of microglia to Abeta phagocytosis
  JOURNAL   Sci Rep 14 (1), 11487 (2024)
   PUBMED   38769091
  REMARK    GeneRIF: Downregulation of miR-181c-5p in Alzheimer's disease
            weakens the response of microglia to Abeta phagocytosis.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 89)
  AUTHORS   Hu,Y., Hu,C., Yin,J., Zhong,J., Deng,Y. and Yang,G.
  TITLE     MiR-181c-5p ameliorates learning and memory in sleep-deprived mice
            via HMGB1/TLR4/NF-kappaB pathway
  JOURNAL   An Acad Bras Cienc 95 (suppl 1), e20220750 (2023)
   PUBMED   37466537
  REMARK    GeneRIF: MiR-181c-5p ameliorates learning and memory in
            sleep-deprived mice via HMGB1/TLR4/NF-kappaB pathway.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 89)
  AUTHORS   Jimenez,M.T., Clark,M.L., Wright,J.M., Michieletto,M.F., Liu,S.,
            Erickson,I., Dohnalova,L., Uhr,G.T., Tello-Cajiao,J., Joannas,L.,
            Williams,A., Gagliani,N., Bewtra,M., Tomov,V.T., Thaiss,C.A. and
            Henao-Mejia,J.
  TITLE     The miR-181 family regulates colonic inflammation through its
            activity in the intestinal epithelium
  JOURNAL   J Exp Med 219 (12) (2022)
   PUBMED   36074090
REFERENCE   5  (bases 1 to 89)
  AUTHORS   Dogan,A.E., Hamid,S.M., Yildirim,A.D., Yildirim,Z., Sen,G.,
            Riera,C.E., Gottlieb,R.A. and Erbay,E.
  TITLE     PACT establishes a posttranscriptional brake on mitochondrial
            biogenesis by promoting the maturation of miR-181c
  JOURNAL   J Biol Chem 298 (7), 102050 (2022)
   PUBMED   35598827
  REMARK    GeneRIF: PACT establishes a posttranscriptional brake on
            mitochondrial biogenesis by promoting the maturation of miR-181c.
REFERENCE   6  (bases 1 to 89)
  AUTHORS   Xu,S., Witmer,P.D., Lumayag,S., Kovacs,B. and Valle,D.
  TITLE     MicroRNA (miRNA) transcriptome of mouse retina and identification
            of a sensory organ-specific miRNA cluster
  JOURNAL   J Biol Chem 282 (34), 25053-25066 (2007)
   PUBMED   17597072
REFERENCE   7  (bases 1 to 89)
  AUTHORS   Tang,F., Kaneda,M., O'Carroll,D., Hajkova,P., Barton,S.C.,
            Sun,Y.A., Lee,C., Tarakhovsky,A., Lao,K. and Surani,M.A.
  TITLE     Maternal microRNAs are essential for mouse zygotic development
  JOURNAL   Genes Dev 21 (6), 644-648 (2007)
   PUBMED   17369397
REFERENCE   8  (bases 1 to 89)
  AUTHORS   Watanabe,T., Takeda,A., Tsukiyama,T., Mise,K., Okuno,T., Sasaki,H.,
            Minami,N. and Imai,H.
  TITLE     Identification and characterization of two novel classes of small
            RNAs in the mouse germline: retrotransposon-derived siRNAs in
            oocytes and germline small RNAs in testes
  JOURNAL   Genes Dev 20 (13), 1732-1743 (2006)
   PUBMED   16766679
REFERENCE   9  (bases 1 to 89)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   10 (bases 1 to 89)
  AUTHORS   Lim,L.P., Glasner,M.E., Yekta,S., Burge,C.B. and Bartel,D.P.
  TITLE     Vertebrate microRNA genes
  JOURNAL   Science 299 (5612), 1540 (2003)
   PUBMED   12624257
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC159266.3.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM608651.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-89                AC159266.3         171122-171210       c
FEATURES             Location/Qualifiers
     source          1..89
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="8"
                     /map="8 40.47 cM"
     gene            1..89
                     /gene="Mir181c"
                     /gene_synonym="mir-181c; Mirn181c"
                     /note="microRNA 181c"
                     /db_xref="GeneID:723819"
                     /db_xref="MGI:MGI:3618737"
                     /db_xref="miRBase:MI0000724"
     precursor_RNA   1..89
                     /gene="Mir181c"
                     /gene_synonym="mir-181c; Mirn181c"
                     /product="microRNA 181c"
                     /db_xref="GeneID:723819"
                     /db_xref="MGI:MGI:3618737"
                     /db_xref="miRBase:MI0000724"
     exon            1..89
                     /gene="Mir181c"
                     /gene_synonym="mir-181c; Mirn181c"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           17..38
                     /ncRNA_class="miRNA"
                     /gene="Mir181c"
                     /gene_synonym="mir-181c; Mirn181c"
                     /product="mmu-miR-181c-5p"
                     /db_xref="miRBase:MIMAT0000674"
                     /db_xref="GeneID:723819"
                     /db_xref="MGI:MGI:3618737"
                     /db_xref="miRBase:MI0000724"
     ncRNA           56..77
                     /ncRNA_class="miRNA"
                     /gene="Mir181c"
                     /gene_synonym="mir-181c; Mirn181c"
                     /product="mmu-miR-181c-3p"
                     /db_xref="miRBase:MIMAT0017068"
                     /db_xref="GeneID:723819"
                     /db_xref="MGI:MGI:3618737"
                     /db_xref="miRBase:MI0000724"
ORIGIN      
gccaagggtttgggggaacattcaacctgtcggtgagtttgggcagctcagacaaaccatcgaccgttgagtggaccccgaggcctgga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]