LOCUS       NM_133256               1665 bp    mRNA    linear   ROD 12-JUN-2024
DEFINITION  Mus musculus GS homeobox 2 (Gsx2), mRNA.
ACCESSION   NM_133256
VERSION     NM_133256.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1665)
  AUTHORS   Liang,X.G., Hoang,K., Meyerink,B.L., Kc,P., Paraiso,K., Wang,L.,
            Jones,I.R., Zhang,Y., Katzman,S., Finn,T.S., Tsyporin,J., Qu,F.,
            Chen,Z., Visel,A., Kriegstein,A., Shen,Y., Pilaz,L.J. and Chen,B.
  TITLE     A conserved molecular logic for neurogenesis to gliogenesis switch
            in the cerebral cortex
  JOURNAL   Proc Natl Acad Sci U S A 121 (20), e2321711121 (2024)
   PUBMED   38713624
REFERENCE   2  (bases 1 to 1665)
  AUTHORS   Talley,M.J., Nardini,D., Ehrman,L.A., Lu,Q.R. and Waclaw,R.R.
  TITLE     Distinct requirements for Tcf3 and Tcf12 during oligodendrocyte
            development in the mouse telencephalon
  JOURNAL   Neural Dev 18 (1), 5 (2023)
   PUBMED   37684687
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1665)
  AUTHORS   Hirose,T., Sugitani,Y., Kurihara,H., Kazama,H., Kusaka,C., Noda,T.,
            Takahashi,H. and Ohno,S.
  TITLE     PAR3 restricts the expansion of neural precursor cells by
            regulating hedgehog signaling
  JOURNAL   Development 149 (21) (2022)
   PUBMED   36218069
REFERENCE   4  (bases 1 to 1665)
  AUTHORS   Magno,L., Asgarian,Z., Apanaviciute,M., Milner,Y.,
            Bengoa-Vergniory,N., Rubin,A.N. and Kessaris,N.
  TITLE     Fate mapping reveals mixed embryonic origin and unique
            developmental codes of mouse forebrain septal neurons
  JOURNAL   Commun Biol 5 (1), 1137 (2022)
   PUBMED   36302841
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1665)
  AUTHORS   Manuel,M., Tan,K.B., Kozic,Z., Molinek,M., Marcos,T.S.,
            Razak,M.F.A., Dobolyi,D., Dobie,R., Henderson,B.E.P.,
            Henderson,N.C., Chan,W.K., Daw,M.I., Mason,J.O. and Price,D.J.
  TITLE     Pax6 limits the competence of developing cerebral cortical cells to
            respond to inductive intercellular signals
  JOURNAL   PLoS Biol 20 (9), e3001563 (2022)
   PUBMED   36067211
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1665)
  AUTHORS   Nagle,D.L., Kozak,C.A., Mano,H., Chapman,V.M. and Bucan,M.
  TITLE     Physical mapping of the Tec and Gabrb1 loci reveals that the Wsh
            mutation on mouse chromosome 5 is associated with an inversion
  JOURNAL   Hum Mol Genet 4 (11), 2073-2079 (1995)
   PUBMED   8589683
REFERENCE   7  (bases 1 to 1665)
  AUTHORS   Sommers,C.L., Huang,K., Shores,E.W., Grinberg,A., Charlick,D.A.,
            Kozak,C.A. and Love,P.E.
  TITLE     Murine txk: a protein tyrosine kinase gene regulated by T cell
            activation
  JOURNAL   Oncogene 11 (2), 245-251 (1995)
   PUBMED   7542761
REFERENCE   8  (bases 1 to 1665)
  AUTHORS   Valerius,M.T., Li,H., Stock,J.L., Weinstein,M., Kaur,S., Singh,G.
            and Potter,S.S.
  TITLE     Gsh-1: a novel murine homeobox gene expressed in the central
            nervous system
  JOURNAL   Dev Dyn 203 (3), 337-351 (1995)
   PUBMED   8589431
REFERENCE   9  (bases 1 to 1665)
  AUTHORS   Hsieh-Li,H.M., Witte,D.P., Szucsik,J.C., Weinstein,M., Li,H. and
            Potter,S.S.
  TITLE     Gsh-2, a murine homeobox gene expressed in the developing brain
  JOURNAL   Mech Dev 50 (2-3), 177-186 (1995)
   PUBMED   7619729
REFERENCE   10 (bases 1 to 1665)
  AUTHORS   Singh,G., Kaur,S., Stock,J.L., Jenkins,N.A., Gilbert,D.J.,
            Copeland,N.G. and Potter,S.S.
  TITLE     Identification of 10 murine homeobox genes
  JOURNAL   Proc Natl Acad Sci U S A 88 (23), 10706-10710 (1991)
   PUBMED   1683707
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AC161192.12.
            
            On Nov 17, 2006 this sequence version replaced NM_133256.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: S79041.1, SRR7345562.4878329.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN01164131
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-737               AC161192.12        201741-202477
            738-1665            AC161192.12        203106-204033
FEATURES             Location/Qualifiers
     source          1..1665
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="5"
                     /map="5 39.55 cM"
     gene            1..1665
                     /gene="Gsx2"
                     /gene_synonym="Gsh-2; Gsh2"
                     /note="GS homeobox 2"
                     /db_xref="GeneID:14843"
                     /db_xref="MGI:MGI:95843"
     exon            1..737
                     /gene="Gsx2"
                     /gene_synonym="Gsh-2; Gsh2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    107..109
                     /gene="Gsx2"
                     /gene_synonym="Gsh-2; Gsh2"
                     /note="upstream in-frame stop codon"
     CDS             161..1078
                     /gene="Gsx2"
                     /gene_synonym="Gsh-2; Gsh2"
                     /note="homeobox protein GSH-2; genomic screened homeo box
                     2; genetic-screened homeobox 2"
                     /codon_start=1
                     /product="GS homeobox 2"
                     /protein_id="NP_573555.1"
                     /db_xref="CCDS:CCDS19350.1"
                     /db_xref="GeneID:14843"
                     /db_xref="MGI:MGI:95843"
                     /translation="

MSRSFYVDSLIIKDSSRPAPSLPESHPGPDFFIPLGMPSPLVMSVSGPGCPSRKSGAFCVCPLCVTSHLHSSRPPAGAGGGATGTAGAAVAGGGVAGGTGALPLLKSQFSPAPGDAQFCPRVSHAHHHHHPPQHHHHHHQPQQPGSAAAAAAAAAAAAAAAAALGHPQHHAPVCAATTYNMSDPRRFHCLSMGGSDTSQVPNGKRMRTAFTSTQLLELEREFSSNMYLSRLRRIEIATYLNLSEKQVKIWFQNRRVKHKKEGKGASRNNHTSCKCVGSQAHYARSEDEDSLSPASANEDKEISPL"

     misc_feature    503..613
                     /gene="Gsx2"
                     /gene_synonym="Gsh-2; Gsh2"
                     /note="propagated from UniProtKB/Swiss-Prot (P31316.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    770..940
                     /gene="Gsx2"
                     /gene_synonym="Gsh-2; Gsh2"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    935..1075
                     /gene="Gsx2"
                     /gene_synonym="Gsh-2; Gsh2"
                     /note="propagated from UniProtKB/Swiss-Prot (P31316.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            738..1665
                     /gene="Gsx2"
                     /gene_synonym="Gsh-2; Gsh2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gaggaccaaccctctccagggacccctttgttcgagtcccagacacctcagcatccccaaggacttgaccgcccgcgtgcgcccagctttccggacagtgctcagatagcagaaggagagaaggggactcagcagcccgcaggacaagccatccatcgacatgtcgcgctccttctacgtggactcactcatcatcaaggactcctcacggcccgcaccctcgctgccggaatcgcacccagggccggatttcttcatcccgctgggcatgccgtccccgttggtgatgtcagtgtccgggcctggctgtccgtcccgcaaaagcggcgctttctgcgtgtgcccgctttgcgtcacctcgcacctgcactcctctcgcccgcccgcaggagctggtggcggagctacggggaccgcgggggctgcagtggcgggcggcggggtggctggaggcaccggcgctctacctttgctcaaaagccagttctctcccgctcctggggacgcgcagttttgcccacgggtgagccacgcacaccatcaccaccacccaccacagcatcatcatcaccatcaccagccccagcagcccggctcggctgcagcggcggccgcggcggcggcggcggcagctgcggcagcggcggctctgggacacccgcagcaccacgcacctgtctgcgccgccactacctacaacatgtcggacccacggagattccactgcctctccatgggaggctccgataccagccaggtacccaatggcaaaaggatgaggacagcgtttaccagcacgcagctcctggagctggagcgagaattctcttccaatatgtacctgtcccgactccggagaatcgagatcgcgacatacctaaacctgtcagagaagcaggtgaaaatctggtttcagaaccgtcgcgtgaagcacaagaaggaggggaaaggcgcttcgaggaacaatcacacaagctgcaagtgcgtgggtagccaggcgcattatgcgcgctccgaggacgaggactccttgtcccctgcctcggctaacgaagacaaggagatttcccccttgtaaaggcagaggctccttctgctacctgctcccggtaccctgccctcctcctccccatcagcacagggaccaaagttctagtccattgccctcattccacctggaaaagaaactctgaaaagtccggggaattcaatgccgggcccgactttgaagctagctcctctttatctgggattccactcagttacggattggttttttgtttgcttttttgttgtttttaatgtaaatatctagaattctaaccagtctcatatatcaggaaaaaccagggttgattaaagtttaacactgtatggggggaggggttggttgaagacgcatgccatttgcccccctgtcttttcagaacttgatgagaagaggggtttctttattgtttttgttgttgttttaaaatgaaatcattgaagttgccattaatatagagagttaaactccgtaggtcttgttttctgaaaattttcatgggggagaattttaaatccaggtctctggaagtccctttgtatgtgaatagttttatataaaatacatatttatatttatttaaataaatgaaacgaaataaatattttttaattcgt

//