LOCUS       NM_027998               1851 bp    mRNA    linear   ROD 30-APR-2024
DEFINITION  Mus musculus claudin 23 (Cldn23), mRNA.
ACCESSION   NM_027998
VERSION     NM_027998.4
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1851)
  AUTHORS   Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
            Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
            Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
            Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
            Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
            Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
            Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
            Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
            Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
            Jackson,S.P. and Balmus,G.
  CONSRTM   Sanger Mouse Genetics Project
  TITLE     Genetic determinants of micronucleus formation in vivo
  JOURNAL   Nature 627 (8002), 130-136 (2024)
   PUBMED   38355793
REFERENCE   2  (bases 1 to 1851)
  AUTHORS   Raya-Sandino,A., Lozada-Soto,K.M., Rajagopal,N.,
            Garcia-Hernandez,V., Luissint,A.C., Brazil,J.C., Cui,G., Koval,M.,
            Parkos,C.A., Nangia,S. and Nusrat,A.
  TITLE     Claudin-23 reshapes epithelial tight junction architecture to
            regulate barrier function
  JOURNAL   Nat Commun 14 (1), 6214 (2023)
   PUBMED   37798277
  REMARK    GeneRIF: Claudin-23 reshapes epithelial tight junction architecture
            to regulate barrier function.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1851)
  AUTHORS   Higashi,A.Y., Higashi,T., Furuse,K., Ozeki,K., Furuse,M. and
            Chiba,H.
  TITLE     Claudin-9 constitutes tight junctions of folliculo-stellate cells
            in the anterior pituitary gland
  JOURNAL   Sci Rep 11 (1), 21642 (2021)
   PUBMED   34737342
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1851)
  AUTHORS   Rostampour,N., Appelt,C.M., Abid,A. and Boughner,J.C.
  TITLE     Expression of new genes in vertebrate tooth development and p63
            signaling
  JOURNAL   Dev Dyn 248 (8), 744-755 (2019)
   PUBMED   30875130
REFERENCE   5  (bases 1 to 1851)
  AUTHORS   Park,K.C., Lee,M., Jeon,Y., Jeon,R., Baek,S.H., Lee,H. and Kim,K.I.
  TITLE     Skin-Specific Deletion of Mis18alpha Impedes Proliferation and
            Stratification of Epidermal Keratinocytes
  JOURNAL   J Invest Dermatol 137 (2), 414-421 (2017)
   PUBMED   27670610
REFERENCE   6  (bases 1 to 1851)
  AUTHORS   Tsukita,S., Yamazaki,Y., Katsuno,T., Tamura,A. and Tsukita,S.
  TITLE     Tight junction-based epithelial microenvironment and cell
            proliferation
  JOURNAL   Oncogene 27 (55), 6930-6938 (2008)
   PUBMED   19029935
  REMARK    Review article
REFERENCE   7  (bases 1 to 1851)
  AUTHORS   Angelow,S., Ahlstrom,R. and Yu,A.S.
  TITLE     Biology of claudins
  JOURNAL   Am J Physiol Renal Physiol 295 (4), F867-F876 (2008)
   PUBMED   18480174
  REMARK    Review article
REFERENCE   8  (bases 1 to 1851)
  AUTHORS   Krause,G., Winkler,L., Mueller,S.L., Haseloff,R.F., Piontek,J. and
            Blasig,I.E.
  TITLE     Structure and function of claudins
  JOURNAL   Biochim Biophys Acta 1778 (3), 631-645 (2008)
   PUBMED   18036336
  REMARK    Review article
REFERENCE   9  (bases 1 to 1851)
  AUTHORS   Ballana,E., Mercader,J.M., Fischel-Ghodsian,N. and Estivill,X.
  TITLE     MRPS18CP2 alleles and DEFA3 absence as putative chromosome 8p23.1
            modifiers of hearing loss due to mtDNA mutation A1555G in the 12S
            rRNA gene
  JOURNAL   BMC Med Genet 8, 81 (2007)
   PUBMED   18154640
  REMARK    Publication Status: Online-Only
REFERENCE   10 (bases 1 to 1851)
  AUTHORS   Katoh,M. and Katoh,M.
  TITLE     CLDN23 gene, frequently down-regulated in intestinal-type gastric
            cancer, is a novel member of CLAUDIN gene family
  JOURNAL   Int J Mol Med 11 (6), 683-689 (2003)
   PUBMED   12736707
  REMARK    GeneRIF: Report on identification and characterization of human
            CLDN23.
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK145246.1, AK037108.1 and
            AV375522.1.
            
            On Aug 14, 2010 this sequence version replaced NM_027998.3.
            
            Summary: This gene encodes a member of the claudin family. Claudins
            are integral membrane proteins and components of tight junction
            strands. Tight junction strands serve as a physical barrier to
            prevent solutes and water from passing freely through the
            paracellular space between epithelial or endothelial cell sheets,
            and also play critical roles in maintaining cell polarity and
            signal transductions. This gene is intronless and the protein
            encoded by this gene is 77% identical to the human homolog.
            [provided by RefSeq, Aug 2010].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-662               AK145246.1         5-666
            663-1848            AK037108.1         618-1803
            1849-1851           AV375522.1         253-255
FEATURES             Location/Qualifiers
     source          1..1851
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="8"
                     /map="8 21.21 cM"
     gene            1..1851
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="claudin 23"
                     /db_xref="GeneID:71908"
                     /db_xref="MGI:MGI:1919158"
     exon            1..1851
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    204..206
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="upstream in-frame stop codon"
     CDS             228..1118
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /codon_start=1
                     /product="claudin-23"
                     /protein_id="NP_082274.1"
                     /db_xref="CCDS:CCDS22246.1"
                     /db_xref="GeneID:71908"
                     /db_xref="MGI:MGI:1919158"
                     /translation="

MRTPVVMTLGMVLTPCGLLLNLVSTLAPGWRLVKGFLDQPVDVVLYQGLWDICREQSSRERECGQPDEWNYFQTQPVQVARGLMITSLATTALGLLLASLGVRCWQDEPHYGLAGLSGVVFFVAGLFSLIPVSWYNHFLSDPDVLAAPSSPVTVQVSYSLVLGYLGSCLLLLGGFSLALSFAPWCEERCRRCRKAPPAGPRRSSISTVYVDWPEPALTPAIKYYSDGQHRPPPTAEHRDTSKLKVGFPMPRPPPKSYTNPMDVLEGEEKKTATSQGGSSSRSTRPCQNSLPCDSDL"

     misc_feature    234..296
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9D7D7.1);
                     transmembrane region"
     misc_feature    240..656
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     misc_feature    471..533
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9D7D7.1);
                     transmembrane region"
     misc_feature    561..623
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9D7D7.1);
                     transmembrane region"
     misc_feature    708..770
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9D7D7.1);
                     transmembrane region"
     misc_feature    897..1115
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9D7D7.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     regulatory      1815..1820
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="hexamer: AATAAA"
     polyA_site      1834
                     /gene="Cldn23"
                     /gene_synonym="2310014B08Rik"
                     /note="major polyA site"
ORIGIN      

tttcgattagggacagcggctgggcgagagggcggagcggttgggacgcgagagaggaggggacttggtgtgagaggctcagtggggacagttccgcgcgagagacaaagagcgcccagagagcgcagcgagcatcgctgctacccagcccggcaacctcgcagattcgaggacagggtgcgcagcggagcagccacagctgctagggacccaagaggctacgcaggatgcggacgccggtggtgatgacgctgggcatggtgctcacgccctgcgggttgctgcttaatcttgtcagtacactggccccgggctggcggctggtgaagggctttctggaccagccagtggacgtggtgctgtaccaggggctgtgggacatatgtcgcgagcagagcagtcgcgaacgcgagtgcggccagcccgacgagtggaactacttccagacccagcctgtgcaggtggcccggggactcatgatcacgtcactggccactaccgccctagggctgctgctggcttccctcggtgtgcgctgttggcaagatgagccccactacgggctagcgggcctctctggcgtggtgtttttcgtcgctggcctcttcagcctcatcccggtctcctggtataaccacttcttgtcagatcccgacgtcctggccgccccgagctcgccggtcacggtgcaggtcagctacagcctggtgctgggctacctaggcagctgcctgctgcttctgggcggcttctctctggcgctcagctttgcgccctggtgtgaagagcgttgtcgccgctgtcgcaaggcgcccccagcaggcccgcgccgcagcagcatcagcaccgtctacgtggactggccggaaccagcgctcacacctgccatcaagtactacagcgacggacagcatcggcctcctcccaccgcagagcacagggacaccagcaagctcaaggttggattcccgatgccacgaccgccacccaagtcctacaccaacccgatggatgtgcttgagggagaagaaaagaagacagccacctcccaaggtggttcctcctctcgcagcactcggccctgccaaaattcgctgccctgtgactccgacctgtagacagggttcacctgagctctgcctggagtctgagggtgacttgaacttctgccagtacatctgcaactagaaccctggtcgccttcctctaactggagggcaagccttccttttctagggccaaactcctctccaaatactaggttgggttcatttatcttttaaggagttttacttttctctccagagggaccaggtcttcttatgcagtgacaagagtgcgtagtgttttctttgcatactgttcatcgcagtagcaacaaaattgcaatcagccaacaggctttaaaacgtccctgaacgtacagtattctaagttaccgtgagccttcacaaacatcattctcgaggttttttgcttttctccctgcttcagtctccagagaacataaatggccaaaaatgttaagtctggctatatttgaaggttatgacataaagccagcagctttaatggcttttatgaagtgaagtgacttgtttaactcctatttatatttctctgtgcatatatagtatttatcttttctaatcacttgtttctgtgtaggaggttgagcttgtcttccaaaagccaaggcgatgctacactgtcctgttcccgagatacctcgccctgaacagagatatattttgtacaaaatgaactgttaagttgcctttggctaacatccatatgtatatatcttatttataaataaaaattgtaaatgtcagtttcggtatccctaca

//