2025-08-21 22:58:42, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS NM_027802 1217 bp mRNA linear ROD 05-AUG-2024 DEFINITION Mus musculus oocyte specific homeobox 1 (Obox1), mRNA. ACCESSION NM_027802 VERSION NM_027802.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1217) AUTHORS Ji,S., Chen,F., Stein,P., Wang,J., Zhou,Z., Wang,L., Zhao,Q., Lin,Z., Liu,B., Xu,K., Lai,F., Xiong,Z., Hu,X., Kong,T., Kong,F., Huang,B., Wang,Q., Xu,Q., Fan,Q., Liu,L., Williams,C.J., Schultz,R.M. and Xie,W. TITLE OBOX regulates mouse zygotic genome activation and early development JOURNAL Nature 620 (7976), 1047-1053 (2023) PUBMED 37459895 REFERENCE 2 (bases 1 to 1217) AUTHORS Wu,L., Wu,Y., Peng,B., Hou,Z., Dong,Y., Chen,K., Guo,M., Li,H., Chen,X., Kou,X., Zhao,Y., Bi,Y., Wang,Y., Wang,H., Le,R., Kang,L. and Gao,S. TITLE Oocyte-Specific Homeobox 1, Obox1, Facilitates Reprogramming by Promoting Mesenchymal-to-Epithelial Transition and Mitigating Cell Hyperproliferation JOURNAL Stem Cell Reports 9 (5), 1692-1705 (2017) PUBMED 29033306 REMARK GeneRIF: Obox1 serves as a strong activator for somatic cell reprogramming through promoting the mesenchymal-to-epithelial transition and mitigating cell hyperproliferation. REFERENCE 3 (bases 1 to 1217) AUTHORS Brici,D., Zhang,Q., Reinhardt,S., Dahl,A., Hartmann,H., Schmidt,K., Goveas,N., Huang,J., Gahurova,L., Kelsey,G., Anastassiadis,K., Stewart,A.F. and Kranz,A. TITLE Setd1b, encoding a histone 3 lysine 4 methyltransferase, is a maternal effect gene required for the oogenic gene expression program JOURNAL Development 144 (14), 2606-2617 (2017) PUBMED 28619824 REFERENCE 4 (bases 1 to 1217) AUTHORS Thompson,C.L., Ng,L., Menon,V., Martinez,S., Lee,C.K., Glattfelder,K., Sunkin,S.M., Henry,A., Lau,C., Dang,C., Garcia-Lopez,R., Martinez-Ferre,A., Pombero,A., Rubenstein,J.L.R., Wakeman,W.B., Hohmann,J., Dee,N., Sodt,A.J., Young,R., Smith,K., Nguyen,T.N., Kidney,J., Kuan,L., Jeromin,A., Kaykas,A., Miller,J., Page,D., Orta,G., Bernard,A., Riley,Z., Smith,S., Wohnoutka,P., Hawrylycz,M.J., Puelles,L. and Jones,A.R. TITLE A high-resolution spatiotemporal atlas of gene expression of the developing mouse brain JOURNAL Neuron 83 (2), 309-323 (2014) PUBMED 24952961 REFERENCE 5 (bases 1 to 1217) AUTHORS Chung,Y.C., Tsai,Y.J., Shiu,T.Y., Sun,Y.Y., Wang,P.F. and Chen,C.L. TITLE Screening large numbers of expression patterns of transcription factors in late stages of the mouse thymus JOURNAL Gene Expr Patterns 11 (1-2), 84-92 (2011) PUBMED 20932939 REFERENCE 6 (bases 1 to 1217) AUTHORS Guo,G., Huss,M., Tong,G.Q., Wang,C., Li Sun,L., Clarke,N.D. and Robson,P. TITLE Resolution of cell fate decisions revealed by single-cell gene expression analysis from zygote to blastocyst JOURNAL Dev Cell 18 (4), 675-685 (2010) PUBMED 20412781 REFERENCE 7 (bases 1 to 1217) AUTHORS Yokoyama,S., Ito,Y., Ueno-Kudoh,H., Shimizu,H., Uchibe,K., Albini,S., Mitsuoka,K., Miyaki,S., Kiso,M., Nagai,A., Hikata,T., Osada,T., Fukuda,N., Yamashita,S., Harada,D., Mezzano,V., Kasai,M., Puri,P.L., Hayashizaki,Y., Okado,H., Hashimoto,M. and Asahara,H. TITLE A systems approach reveals that the myogenesis genome network is regulated by the transcriptional repressor RP58 JOURNAL Dev Cell 17 (6), 836-848 (2009) PUBMED 20059953 REFERENCE 8 (bases 1 to 1217) AUTHORS Cheng,W.C., Hsieh-Li,H.M., Yeh,Y.J. and Li,H. TITLE Mice lacking the Obox6 homeobox gene undergo normal early embryonic development and are fertile JOURNAL Dev Dyn 236 (9), 2636-2642 (2007) PUBMED 17676645 REFERENCE 9 (bases 1 to 1217) AUTHORS Rajkovic,A., Yan,C., Yan,W., Klysik,M. and Matzuk,M.M. TITLE Obox, a family of homeobox genes preferentially expressed in germ cells JOURNAL Genomics 79 (5), 711-717 (2002) PUBMED 11991721 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AC189859.1. On Nov 17, 2006 this sequence version replaced NM_027802.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript exon combination :: AK018362.1, AK136061.1 [ECO:0000332] RNAseq introns :: partial sample support SAMN00849374 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-59 AC189859.1 124218-124276 60-321 AC189859.1 132078-132339 322-521 AC189859.1 132466-132665 522-1217 AC189859.1 133112-133807 FEATURES Location/Qualifiers source 1..1217 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 8.5 cM" gene 1..1217 /gene="Obox1" /gene_synonym="7420700M11Rik" /note="oocyte specific homeobox 1" /db_xref="GeneID:71468" /db_xref="MGI:MGI:1918718" exon 1..59 /gene="Obox1" /gene_synonym="7420700M11Rik" /inference="alignment:Splign:2.1.0" exon 60..321 /gene="Obox1" /gene_synonym="7420700M11Rik" /inference="alignment:Splign:2.1.0" misc_feature 87..89 /gene="Obox1" /gene_synonym="7420700M11Rik" /note="upstream in-frame stop codon" CDS 105..719 /gene="Obox1" /gene_synonym="7420700M11Rik" /codon_start=1 /product="oocyte-specific homeobox protein 1" /protein_id="NP_082078.1" /db_xref="CCDS:CCDS20837.1" /db_xref="GeneID:71468" /db_xref="MGI:MGI:1918718" /translation="
MAEGPSLHPKLQVDSNIPIEISSQIPQEPARNLAFQMRQSPLVTPGSTTKSSLSVPERNLLKQESQGPSRQSGCMLLSDKYVNKQTGPMASRKFRKERTVYTKEQQGLLQKHFDECQYPNKKKIVELALSVGVTKREIKIWFKNNRAKYRRMNLQNIEQVLPESNGSSKAVSESTHFPVVASDNGESMCSGTFGEDSIPKFNCS"
misc_feature 186..323 /gene="Obox1" /gene_synonym="7420700M11Rik" /note="propagated from UniProtKB/Swiss-Prot (Q9D350.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 387..557 /gene="Obox1" /gene_synonym="7420700M11Rik" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 322..521 /gene="Obox1" /gene_synonym="7420700M11Rik" /inference="alignment:Splign:2.1.0" exon 522..1217 /gene="Obox1" /gene_synonym="7420700M11Rik" /inference="alignment:Splign:2.1.0" ORIGIN
tgagtagaattaaaacagccagaggatttagcaagttacagcaaccctctggattcctggttatccagtacaggaacatactccaataaattcagaacacacaaatggcggaaggtccctccttgcatccaaaactccaagtggattcgaatatacccatagaaataagttcccaaatacctcaagaaccggcaaggaacctagcttttcaaatgcgtcagagtcccctagtgaccccaggaagtacaacgaaatcaagtctttcagtccctgaaaggaacctacttaagcaagagtctcaaggaccatcaagacaatcaggttgtatgctactgtcagataaatatgttaacaaacaaactggcccaatggcttcaagaaagtttcgaaaagaacgaactgtgtacaccaaagaacagcagggcctgctgcaaaaacattttgatgagtgccagtacccaaacaagaagaaaattgtggagctggcactatcagttggtgttacaaagagggagattaagatctggttcaagaacaaccgagctaagtacaggcggatgaacctccagaatattgaacaagtactgccagagtcaaatggaagctctaaagcggtttctgagtcaacccattttcctgttgttgcctctgacaatggagagtccatgtgttcaggcacatttggtgaggattccattcccaaattcaactgcagctaggaatcttccctgcattgttttcaggcctgagatggggccatgtgttgtacgcaagaatacgtgcttgatggccatacccctgttacagcttggaactctggtcaatcagcagcagttgaatatcacacttacttagcagtagctgaagctccagtcgggctggcatatgctgcccaagccccagaggatgctcacaattcagctccatctgcagacaagctctagcaaaggatccttgaagacttttgacacatcagatgactggcttgccatgagaaacccctccactccagcttacacctctcaggtccttgacgagtccaaccttacagccatgaagaagtgtgttatatacacctttattctctgtatttggagaaataaccagtcttatctgtagaagcatcataccactgtgttttatgtagtgcgattgtttgaaattcagtttaggtcttaattttttattgttagagtatatgttcattaaataaaagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]