LOCUS       NM_009902               1263 bp    mRNA    linear   ROD 20-SEP-2024
DEFINITION  Mus musculus claudin 3 (Cldn3), mRNA.
ACCESSION   NM_009902
VERSION     NM_009902.4
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1263)
  AUTHORS   Radvanyi,Z., Schnitzbauer,U., Pastor-Arroyo,E.M., Holker,S.,
            Himmerkus,N., Bleich,M., Muller,D., Breiderhoff,T., Hernando,N. and
            Wagner,C.A.
  TITLE     Absence of claudin-3 does not alter intestinal absorption of
            phosphate in mice
  JOURNAL   Pflugers Arch 476 (10), 1597-1612 (2024)
   PUBMED   39115555
  REMARK    GeneRIF: Absence of claudin-3 does not alter intestinal absorption
            of phosphate in mice.
REFERENCE   2  (bases 1 to 1263)
  AUTHORS   Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
            Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
            Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
            Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
            Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
            Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
            Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
            Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
            Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
            Jackson,S.P. and Balmus,G.
  CONSRTM   Sanger Mouse Genetics Project
  TITLE     Genetic determinants of micronucleus formation in vivo
  JOURNAL   Nature 627 (8002), 130-136 (2024)
   PUBMED   38355793
REFERENCE   3  (bases 1 to 1263)
  AUTHORS   Mak,S. and Hammes,A.
  TITLE     Canonical and Non-Canonical Localization of Tight Junction Proteins
            during Early Murine Cranial Development
  JOURNAL   Int J Mol Sci 25 (3), 1426 (2024)
   PUBMED   38338705
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1263)
  AUTHORS   Maezawa,S., Yukawa,M., Hasegawa,K., Sugiyama,R., Iizuka,M., Hu,M.,
            Sakashita,A., Vidal,M., Koseki,H., Barski,A., DeFalco,T. and
            Namekawa,S.H.
  TITLE     PRC1 suppresses a female gene regulatory network to ensure
            testicular differentiation
  JOURNAL   Cell Death Dis 14 (8), 501 (2023)
   PUBMED   37542070
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1263)
  AUTHORS   Suzuki,K., Yamaga,K., Tokumasu,R., Katsuno,T., Tanaka,H., Chiba,S.,
            Yagi,T., Katayama,I., Tamura,A., Murota,H. and Tsukita,S.
  TITLE     Double mutation of claudin-1 and claudin-3 causes alopecia in
            infant mice
  JOURNAL   Ann N Y Acad Sci 1523 (1), 51-61 (2023)
   PUBMED   37002535
  REMARK    GeneRIF: Double mutation of claudin-1 and claudin-3 causes alopecia
            in infant mice.
REFERENCE   6  (bases 1 to 1263)
  AUTHORS   Furuse,M., Sasaki,H. and Tsukita,S.
  TITLE     Manner of interaction of heterogeneous claudin species within and
            between tight junction strands
  JOURNAL   J Cell Biol 147 (4), 891-903 (1999)
   PUBMED   10562289
REFERENCE   7  (bases 1 to 1263)
  AUTHORS   Kubota,K., Furuse,M., Sasaki,H., Sonoda,N., Fujita,K., Nagafuchi,A.
            and Tsukita,S.
  TITLE     Ca(2+)-independent cell-adhesion activity of claudins, a family of
            integral membrane proteins localized at tight junctions
  JOURNAL   Curr Biol 9 (18), 1035-1038 (1999)
   PUBMED   10508613
REFERENCE   8  (bases 1 to 1263)
  AUTHORS   Morita,K., Furuse,M., Fujimoto,K. and Tsukita,S.
  TITLE     Claudin multigene family encoding four-transmembrane domain protein
            components of tight junction strands
  JOURNAL   Proc Natl Acad Sci U S A 96 (2), 511-516 (1999)
   PUBMED   9892664
REFERENCE   9  (bases 1 to 1263)
  AUTHORS   Paperna,T., Peoples,R., Wang,Y.K., Kaplan,P. and Francke,U.
  TITLE     Genes for the CPE receptor (CPETR1) and the human homolog of RVP1
            (CPETR2) are localized within the Williams-Beuren syndrome deletion
  JOURNAL   Genomics 54 (3), 453-459 (1998)
   PUBMED   9878248
REFERENCE   10 (bases 1 to 1263)
  AUTHORS   Katahira,J., Sugiyama,H., Inoue,N., Horiguchi,Y., Matsuda,M. and
            Sugimoto,N.
  TITLE     Clostridium perfringens enterotoxin utilizes two structurally
            related membrane proteins as functional receptors in vivo
  JOURNAL   J Biol Chem 272 (42), 26652-26658 (1997)
   PUBMED   9334247
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK002672.1 and AV041302.2.
            
            On Aug 4, 2010 this sequence version replaced NM_009902.3.
            
            Summary: This gene encodes a member of the claudin family. Claudins
            are integral membrane proteins and components of tight junction
            strands. Tight junction strands serve as a physical barrier to
            prevent solutes and water from passing freely through the
            paracellular space between epithelial or endothelial cell sheets,
            and also play critical roles in maintaining cell polarity and
            signal transductions. The protein encoded by this gene is a
            low-affinity receptor for clostridium perfringens enterotoxin (CPE)
            produced by the bacterium Clostridium perfringens, and the
            interaction with CPE results in increased membrane permeability by
            forming small pores in plasma membrane. This protein is highly
            overexpressed in uterine carcinosarcoma. This protein is also
            predominantly present in brain endothelial cells, where it plays a
            specific role in the establishment and maintenance of blood brain
            barrier tight junction morphology. [provided by RefSeq, Aug 2012].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AK002672.1 [ECO:0000345]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1199              AK002672.1         2-1200
            1200-1263           AV041302.2         218-281
FEATURES             Location/Qualifiers
     source          1..1263
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="5"
                     /map="5 74.93 cM"
     gene            1..1263
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="claudin 3"
                     /db_xref="GeneID:12739"
                     /db_xref="MGI:MGI:1329044"
     exon            1..1263
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /inference="alignment:Splign:2.1.0"
     CDS             232..891
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="CPE-R 2; CPE-receptor 2; clostridium perfringens
                     enterotoxin receptor 2"
                     /codon_start=1
                     /product="claudin-3"
                     /protein_id="NP_034032.1"
                     /db_xref="CCDS:CCDS19729.1"
                     /db_xref="GeneID:12739"
                     /db_xref="MGI:MGI:1329044"
                     /translation="

MSMGLEITGTSLAVLGWLCTIVCCALPMWRVSAFIGSSIITAQITWEGLWMNCVVQSTGQMQCKMYDSLLALPQDLQAARALIVVSILLAAFGLLVALVGAQCTNCVQDETAKAKITIVAGVLFLLAALLTLVPVSWSANTIIRDFYNPLVPEAQKREMGAGLYVGWAAAALQLLGGALLCCSCPPRDKYAPTKILYSAPRSTGPGTGTGTAYDRKDYV"

     misc_feature    238..732
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     misc_feature    256..318
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1);
                     transmembrane region"
     misc_feature    472..534
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1);
                     transmembrane region"
     misc_feature    577..639
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1);
                     transmembrane region"
     misc_feature    709..771
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1);
                     transmembrane region"
     misc_feature    820..822
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0007744|PubMed:17242355; propagated from
                     UniProtKB/Swiss-Prot (Q9Z0G9.1); phosphorylation site"
     misc_feature    823..825
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q63400; propagated from
                     UniProtKB/Swiss-Prot (Q9Z0G9.1); phosphorylation site"
     misc_feature    883..888
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z0G9.1);
                     Region: Interactions with TJP1, TJP2 and TJP3.
                     /evidence=ECO:0000250"
     regulatory      1237..1242
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="hexamer: AATAAA"
     polyA_site      1260
                     /gene="Cldn3"
                     /gene_synonym="Cpetr2; mRVP1"
                     /note="major polyA site"
ORIGIN      

agtctcagaagccagtctccaaagccacaggcaggtgcaggggcagtctctgtgcgagccccaggagaggagccgttaagcgcgctccgtcctttgccacccacccgtcgttcccggcgacagacgtccgtcagttttcgaagggcagttgattcccaggtccagcggccgcgatccctggtctcccagtcccctgagctgcccggccgagccggttcaagtccagcagccatgtccatgggcctggagatcaccggcacgtcgctggccgtgctgggctggctgtgcaccatcgtgtgctgcgcccttcccatgtggcgcgtttcggccttcatcggcagcagcatcatcacggcgcagatcacctgggagggcctgtggatgaactgcgtggtgcagagcaccggtcagatgcagtgcaaaatgtacgactcgctgctggccctgccgcaggacctgcaggccgcccgagccctcatcgtggtgtccatcctgctggccgccttcgggctcctcgtggcgctcgtgggcgcccagtgtaccaactgcgtacaagacgagacggccaaggccaagatcaccatcgtggcgggagtgcttttcctgttggcggctctgctcaccttagtaccggtgtcctggtcggccaacaccatcatcagggatttctataacccgttggtgcccgaggcccagaagcgggagatgggagctgggttgtacgtgggctgggctgccgccgcgctgcagttgctagggggcgccttgctgtgttgctcctgcccaccgcgcgacaagtatgcacccaccaagatcctctattctgcgccgcgatccaccggccctggcaccggtaccggcaccgcctacgaccgcaaggactacgtctgaggggccgggtgcacgcagaccgtaccgtcaccactaccagcagtcgatgaaccccacccgtccagcgtgcagcctcgcgtctgagaccaccccaccttccagatggtgacagacgacacacagtctgcttgctaggctggaagaggacagacaggctggcatctccccttctccggctgccacctgactaccgggcctaggaactgtccaagccgaatggacaaagaaacctcgcccttcccaagaactgggctggggtggccactgcagctacttgccagccccgcagaagctcacagtgggcagagacaggcaaaccatgaaacgggccatttcatatttttcaataaaagtctttcgttttttgcagtc

//