GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-08 15:01:03, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_009095                733 bp    mRNA    linear   ROD 17-DEC-2024
DEFINITION  Mus musculus ribosomal protein S5 (Rps5), transcript variant 2,
            mRNA.
ACCESSION   NM_009095
VERSION     NM_009095.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 733)
  AUTHORS   Susanto,T.T., Hung,V., Levine,A.G., Chen,Y., Kerr,C.H., Yoo,Y.,
            Oses-Prieto,J.A., Fromm,L., Zhang,Z., Lantz,T.C., Fujii,K.,
            Wernig,M., Burlingame,A.L., Ruggero,D. and Barna,M.
  TITLE     RAPIDASH: Tag-free enrichment of ribosome-associated proteins
            reveals composition dynamics in embryonic tissue, cancer cells, and
            macrophages
  JOURNAL   Mol Cell 84 (18), 3545-3563 (2024)
   PUBMED   39260367
REFERENCE   2  (bases 1 to 733)
  AUTHORS   Yin,D. and Shen,G.
  TITLE     Exosomes from adipose-derived stem cells regulate macrophage
            polarization and accelerate diabetic wound healing via the
            circ-Rps5/miR-124-3p axis
  JOURNAL   Immun Inflamm Dis 12 (6), e1274 (2024)
   PUBMED   38888351
  REMARK    GeneRIF: Exosomes from adipose-derived stem cells regulate
            macrophage polarization and accelerate diabetic wound healing via
            the circ-Rps5/miR-124-3p axis.
REFERENCE   3  (bases 1 to 733)
  AUTHORS   Li,H., Huo,Y., He,X., Yao,L., Zhang,H., Cui,Y., Xiao,H., Xie,W.,
            Zhang,D., Wang,Y., Zhang,S., Tu,H., Cheng,Y., Guo,Y., Cao,X.,
            Zhu,Y., Jiang,T., Guo,X., Qin,Y. and Sha,J.
  TITLE     A male germ-cell-specific ribosome controls male fertility
  JOURNAL   Nature 612 (7941), 725-731 (2022)
   PUBMED   36517592
REFERENCE   4  (bases 1 to 733)
  AUTHORS   Harnett,D., Ambrozkiewicz,M.C., Zinnall,U., Rusanova,A.,
            Borisova,E., Drescher,A.N., Couce-Iglesias,M., Villamil,G.,
            Dannenberg,R., Imami,K., Munster-Wandowski,A., Fauler,B.,
            Mielke,T., Selbach,M., Landthaler,M., Spahn,C.M.T., Tarabykin,V.,
            Ohler,U. and Kraushar,M.L.
  TITLE     A critical period of translational control during brain development
            at codon resolution
  JOURNAL   Nat Struct Mol Biol 29 (12), 1277-1290 (2022)
   PUBMED   36482253
REFERENCE   5  (bases 1 to 733)
  AUTHORS   Zhang,M., Chen,D., Xia,J., Han,W., Cui,X., Neuenkirchen,N.,
            Hermes,G., Sestan,N. and Lin,H.
  TITLE     Post-transcriptional regulation of mouse neurogenesis by Pumilio
            proteins
  JOURNAL   Genes Dev 31 (13), 1354-1369 (2017)
   PUBMED   28794184
REFERENCE   6  (bases 1 to 733)
  AUTHORS   Stryke,D., Kawamoto,M., Huang,C.C., Johns,S.J., King,L.A.,
            Harper,C.A., Meng,E.C., Lee,R.E., Yee,A., L'Italien,L.,
            Chuang,P.T., Young,S.G., Skarnes,W.C., Babbitt,P.C. and Ferrin,T.E.
  TITLE     BayGenomics: a resource of insertional mutations in mouse embryonic
            stem cells
  JOURNAL   Nucleic Acids Res 31 (1), 278-281 (2003)
   PUBMED   12520002
REFERENCE   7  (bases 1 to 733)
  AUTHORS   Reymond,A., Marigo,V., Yaylaoglu,M.B., Leoni,A., Ucla,C.,
            Scamuffa,N., Caccioppoli,C., Dermitzakis,E.T., Lyle,R., Banfi,S.,
            Eichele,G., Antonarakis,S.E. and Ballabio,A.
  TITLE     Human chromosome 21 gene expression atlas in the mouse
  JOURNAL   Nature 420 (6915), 582-586 (2002)
   PUBMED   12466854
REFERENCE   8  (bases 1 to 733)
  AUTHORS   Pfisterer,P., Ehlermann,J., Hegen,M. and Schorle,H.
  TITLE     A subtractive gene expression screen suggests a role of
            transcription factor AP-2 alpha in control of proliferation and
            differentiation
  JOURNAL   J Biol Chem 277 (8), 6637-6644 (2002)
   PUBMED   11741941
REFERENCE   9  (bases 1 to 733)
  AUTHORS   Vizirianakis,I.S., Pappas,I.S., Gougoumas,D. and Tsiftsoglou,A.S.
  TITLE     Expression of ribosomal protein S5 cloned gene during
            differentiation and apoptosis in murine erythroleukemia (MEL) cells
  JOURNAL   Oncol Res 11 (9), 409-419 (1999)
   PUBMED   10821535
REFERENCE   10 (bases 1 to 733)
  AUTHORS   Vanegas,N., Castaneda,V., Santamaria,D., Hernandez,P.,
            Schvartzman,J.B. and Krimer,D.B.
  TITLE     Cloning, sequencing and expression in MEL cells of a cDNA encoding
            the mouse ribosomal protein S5
  JOURNAL   Biochim Biophys Acta 1357 (1), 1-4 (1997)
   PUBMED   9202169
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC107704.8.
            
            On Mar 1, 2023 this sequence version replaced NM_009095.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: CA461462.1, CA787280.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849375
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-71                AC107704.8         141288-141358
            72-180              AC107704.8         141943-142051
            181-390             AC107704.8         144362-144571
            391-519             AC107704.8         144707-144835
            520-618             AC107704.8         145366-145464
            619-733             AC107704.8         145542-145656
FEATURES             Location/Qualifiers
     source          1..733
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 7.69 cM"
     gene            1..733
                     /gene="Rps5"
                     /note="ribosomal protein S5"
                     /db_xref="GeneID:20103"
                     /db_xref="MGI:MGI:1097682"
     exon            1..71
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            72..180
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     CDS             73..687
                     /gene="Rps5"
                     /note="40S ribosomal protein S5; S5 ribosomal protein"
                     /codon_start=1
                     /product="small ribosomal subunit protein uS7"
                     /protein_id="NP_033121.2"
                     /db_xref="CCDS:CCDS20817.1"
                     /db_xref="GeneID:20103"
                     /db_xref="MGI:MGI:1097682"
                     /translation="
MTEWEAATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSSNSYAIKKKDELERVAKSNR"
     misc_feature    73..75
                     /gene="Rps5"
                     /note="N-acetylmethionine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    76..78
                     /gene="Rps5"
                     /note="N-acetylthreonine, in 40S ribosomal protein S5,
                     N-terminally processed.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    112..114
                     /gene="Rps5"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); phosphorylation site"
     misc_feature    124..684
                     /gene="Rps5"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(124..126,211..219,223..234,331..333,343..345)
                     /gene="Rps5"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    211..213
                     /gene="Rps5"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); acetylation site"
     misc_feature    order(223..225,229..231,241..252,259..261,283..285,
                     292..294,298..312,322..336,343..345,463..471,475..477,
                     505..507,526..528,547..549,556..558,574..579)
                     /gene="Rps5"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(355..357,364..369,376..378,574..576,580..585)
                     /gene="Rps5"
                     /note="S25 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(460..462,469..471,475..477,682..684)
                     /gene="Rps5"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    496..498
                     /gene="Rps5"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P46782; propagated from
                     UniProtKB/Swiss-Prot (P97461.4); phosphorylation site"
     exon            181..390
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            391..519
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            520..618
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     exon            619..733
                     /gene="Rps5"
                     /inference="alignment:Splign:2.1.0"
     regulatory      705..710
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Rps5"
                     /note="hexamer: AATAAA"
     polyA_site      733
                     /gene="Rps5"
                     /note="major polyA site"
ORIGIN      
ctcttcctgtctgtatcagggcggcgcgtggtccacgccgagcgactgagaagcccagtctgcgccctcaggatgactgagtgggaagcagccacaccagcggtggcagagacccctgacatcaagctctttgggaaatggagcactgatgacgtgcagatcaacgatatttctctgcaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgccggacggtatgctgccaagcgcttccgcaaagcacaatgtcccatcgtggagcgccttactaactccatgatgatgcatggtcgtaacaacggcaagaagctcatgactgtgcgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggccggtacagtgagacgacaggctgtggatgtgtccccactgcgtcgagtgaatcaggccatctggctgctgtgcacaggggctcgtgaggctgctttccggaacatcaagaccatcgccgagtgccttgcagatgagctcattaatgctgccaagggctcctccaattcctatgccatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaactgtgtcctttggaacaactata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]