2025-08-21 23:00:41, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS NM_008257 1372 bp mRNA linear ROD 19-NOV-2024 DEFINITION Mus musculus H6 homeobox 3 (Hmx3), mRNA. ACCESSION NM_008257 VERSION NM_008257.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1372) AUTHORS Sivori,M., Dempsey,B., Chettouh,Z., Boismoreau,F., Ayerdi,M., Eymael,A., Baulande,S., Lameiras,S., Coulpier,F., Delattre,O., Rohrer,H., Mirabeau,O. and Brunet,J.F. TITLE The pelvic organs receive no parasympathetic innervation JOURNAL Elife 12, 91576 (2024) PUBMED 38488657 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1372) AUTHORS Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A., Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R., Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J., Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z., Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J., Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L., Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J., Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B., Jackson,S.P. and Balmus,G. CONSRTM Sanger Mouse Genetics Project TITLE Genetic determinants of micronucleus formation in vivo JOURNAL Nature 627 (8002), 130-136 (2024) PUBMED 38355793 REFERENCE 3 (bases 1 to 1372) AUTHORS Kaiser,M., Wojahn,I., Rudat,C., Ludtke,T.H., Christoffels,V.M., Moon,A., Kispert,A. and Trowe,M.O. TITLE Regulation of otocyst patterning by Tbx2 and Tbx3 is required for inner ear morphogenesis in the mouse JOURNAL Development 148 (8) (2021) PUBMED 33795231 REFERENCE 4 (bases 1 to 1372) AUTHORS Ingham,N.J., Pearson,S.A., Vancollie,V.E., Rook,V., Lewis,M.A., Chen,J., Buniello,A., Martelletti,E., Preite,L., Lam,C.C., Weiss,F.D., Powis,Z., Suwannarat,P., Lelliott,C.J., Dawson,S.J., White,J.K. and Steel,K.P. TITLE Mouse screen reveals multiple new genes underlying mouse and human hearing loss JOURNAL PLoS Biol 17 (4), e3000194 (2019) PUBMED 30973865 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1372) AUTHORS Corman,T.S., Bergendahl,S.E. and Epstein,D.J. TITLE Distinct temporal requirements for Sonic hedgehog signaling in development of the tuberal hypothalamus JOURNAL Development 145 (21) (2018) PUBMED 30291164 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1372) AUTHORS Hadrys,T., Braun,T., Rinkwitz-Brandt,S., Arnold,H.H. and Bober,E. TITLE Nkx5-1 controls semicircular canal formation in the mouse inner ear JOURNAL Development 125 (1), 33-39 (1998) PUBMED 9389661 REFERENCE 7 (bases 1 to 1372) AUTHORS Rinkwitz-Brandt,S., Arnold,H.H. and Bober,E. TITLE Regionalized expression of Nkx5-1, Nkx5-2, Pax2 and sek genes during mouse inner ear development JOURNAL Hear Res 99 (1-2), 129-138 (1996) PUBMED 8970821 REFERENCE 8 (bases 1 to 1372) AUTHORS Rinkwitz-Brandt,S., Justus,M., Oldenettel,I., Arnold,H.H. and Bober,E. TITLE Distinct temporal expression of mouse Nkx-5.1 and Nkx-5.2 homeobox genes during brain and ear development JOURNAL Mech Dev 52 (2-3), 371-381 (1995) PUBMED 8541222 REFERENCE 9 (bases 1 to 1372) AUTHORS Stadler,H.S., Murray,J.C., Leysens,N.J., Goodfellow,P.J. and Solursh,M. TITLE Phylogenetic conservation and physical mapping of members of the H6 homeobox gene family JOURNAL Mamm Genome 6 (6), 383-388 (1995) PUBMED 7647458 REFERENCE 10 (bases 1 to 1372) AUTHORS Bober,E., Baum,C., Braun,T. and Arnold,H.H. TITLE A novel NK-related mouse homeobox gene: expression in central and peripheral nervous structures during embryonic development JOURNAL Dev Biol 162 (1), 288-303 (1994) PUBMED 7510254 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC159994.7, BE956569.1, BE649795.1 and AI326757.1. On Oct 2, 2007 this sequence version replaced NM_008257.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC139482.1, AI528548.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849376, SAMN00849377 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-205 AC159994.7 92560-92764 206-486 BE956569.1 1-281 487-787 AC159994.7 93648-93948 788-1286 BE649795.1 1-499 c 1287-1372 AI326757.1 1-86 c FEATURES Location/Qualifiers source 1..1372 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 74.32 cM" gene 1..1372 /gene="Hmx3" /gene_synonym="Nkx-5.1; Nkx5-1; Nkx5.1" /note="H6 homeobox 3" /db_xref="GeneID:15373" /db_xref="MGI:MGI:107160" CDS 1..1071 /gene="Hmx3" /gene_synonym="Nkx-5.1; Nkx5-1; Nkx5.1" /note="homeobox protein Nkx-5.1; homeobox protein H6 family member 3; H6 homeo box 3" /codon_start=1 /product="homeobox protein HMX3" /protein_id="NP_032283.3" /db_xref="CCDS:CCDS21917.1" /db_xref="GeneID:15373" /db_xref="MGI:MGI:107160" /translation="
MPEPGPDASGTASAPPPQPPPQPPAPKESPFSIRNLLNGDHHRPPPKPQPPPRTLFAPASAAAAAAAAAAAAAKGALEGAAGFALSQVGDLAFPRFEIPAQRFALPAHYLERSPAWWYPYTLTPAGGHLPRPEASEKALLRDSSPASGTDRDSPEPLLKADPDHKELDSKSPDEIILEESDSEEGKKEGEAVPGAAGTTVGATTATPGSEDWKAGAESPEKKPACRKKKTRTVFSRSQVFQLESTFDMKRYLSSSERAGLAASLHLTETQVKIWFQNRRNKWKRQLAAELEAANLSHAAAQRIVRVPILYHENSAAEGAAAAAGAPVPVSQPLLTFPHPVYYSHPVVSSVPLLRPV"
misc_feature 682..852 /gene="Hmx3" /gene_synonym="Nkx-5.1; Nkx5-1; Nkx5.1" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 1..400 /gene="Hmx3" /gene_synonym="Nkx-5.1; Nkx5-1; Nkx5.1" /inference="alignment:Splign:2.1.0" exon 401..1372 /gene="Hmx3" /gene_synonym="Nkx-5.1; Nkx5-1; Nkx5.1" /inference="alignment:Splign:2.1.0" ORIGIN
atgccggagcccgggccggacgcctcgggcactgccagcgcgccgcccccgcagccaccgccccaacctcccgcgcccaaggaatccccgttctccatcaggaacctgctcaacggagaccatcaccggccgcccccgaagcctcagccgcccccacgaacgctctttgctccggcctcggctgctgccgccgccgccgccgctgcggccgccgcagccaaaggtgccctggagggcgccgcgggcttcgcgctctcgcaggtgggcgacctggctttcccccgctttgagatcccagcgcagaggtttgccctgcccgcgcactacctggagcgctccccggcctggtggtacccctacaccctgacccccgccggcggtcacctcccgcgaccagaagcctcggaaaaggccctcctgcgagactcctcccctgcgtccggcaccgatcgagactccccggagcctctgctcaaggctgaccccgaccacaaggagctggactccaagagcccggacgagatcattctggaagagagcgactcggaggaaggcaaaaaagaaggcgaggcggtgcctggcgcggccgggacgaccgtaggggcgactacggcgacaccgggctcagaggactggaaggcgggcgccgagagtcccgagaagaagccggcgtgccgcaaaaagaagacgcgcaccgtcttctcgcgcagccaggtcttccagctcgagtccacattcgacatgaaacgctacctgagcagctcggagcgcgctggcctggccgcgtcgcttcacctcaccgagacgcaggtcaagatctggttccagaatcgccgcaacaagtggaagcgacagctggcggccgagctggaggcggccaacctgagccacgccgctgcgcagcgcatcgtacgcgtgcccatcctctaccacgagaactctgcggccgagggggcggcagcggctgcgggggcaccggtgccagtcagccagccgctgctcaccttcccgcacccagtctactactcgcacccggtggtctcgtccgtgcccctactaaggccggtgtgagatgggacaggggacagggagtgagcacccggccaccttttggggaccccggaggagactgggccgggccgagggtgccgggctgtggccagcgaccttgggctcactgccttgcctcccaccccccaatagcattttgtaagtatttgcaatgcattttcgtgcaattaattcctatgaatttgaggcgcttctcctcttatttttggttttgcttaccattgagagaaaacggggtggggcaggggggaacgacaaaattaccaggtcaaaacttccaattgaaagttctttaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]