2025-04-20 10:40:05, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001428406 1603 bp mRNA linear ROD 15-JUN-2024 DEFINITION Mus musculus cyclin A1 (Ccna1), transcript variant 5, mRNA. ACCESSION NM_001428406 XM_030252400 VERSION NM_001428406.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1603) AUTHORS Du,X., Zang,C. and Wang,Q. TITLE Cyclin A1 (CCNA1) inhibits osteoporosis by suppressing transforming growth factor-beta (TGF-beta) pathway in osteoblasts JOURNAL BMC Musculoskelet Disord 25 (1), 206 (2024) PUBMED 38454404 REMARK GeneRIF: Cyclin A1 (CCNA1) inhibits osteoporosis by suppressing transforming growth factor-beta (TGF-beta) pathway in osteoblasts. Publication Status: Online-Only REFERENCE 2 (bases 1 to 1603) AUTHORS Chong,D., Gu,Y., Zhang,T., Xu,Y., Bu,D., Chen,Z., Xu,N., Li,L., Zhu,X., Wang,H., Li,Y., Zheng,F., Wang,D., Li,P., Xu,L., Hu,Z. and Li,C. TITLE Neonatal ketone body elevation regulates postnatal heart development by promoting cardiomyocyte mitochondrial maturation and metabolic reprogramming JOURNAL Cell Discov 8 (1), 106 (2022) PUBMED 36220812 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1603) AUTHORS Gindi,N., Grossman,H., Bar-Joseph,H., Miller,I., Nemerovsky,L., Hadas,R., Nevo,N., Galiani,D., Dekel,N. and Shalgi,R. TITLE Fyn and argonaute 2 participate in maternal-mRNA degradation during mouse oocyte maturation JOURNAL Cell Cycle 21 (8), 792-804 (2022) PUBMED 35104175 REFERENCE 4 (bases 1 to 1603) AUTHORS Ciemerych,M.A. and Sicinski,P. TITLE Cell cycle in mouse development JOURNAL Oncogene 24 (17), 2877-2898 (2005) PUBMED 15838522 REMARK Review article REFERENCE 5 (bases 1 to 1603) AUTHORS Wolgemuth,D.J., Lele,K.M., Jobanputra,V. and Salazar,G. TITLE The A-type cyclins and the meiotic cell cycle in mammalian male germ cells JOURNAL Int J Androl 27 (4), 192-199 (2004) PUBMED 15271198 REMARK Review article REFERENCE 6 (bases 1 to 1603) AUTHORS Winston,N. TITLE Regulation of early embryo development: functional redundancy between cyclin subtypes JOURNAL Reprod Fertil Dev 13 (1), 59-67 (2001) PUBMED 11545166 REMARK Review article REFERENCE 7 (bases 1 to 1603) AUTHORS Zeichner-David,M., Vo,H., Tan,H., Diekwisch,T., Berman,B., Thiemann,F., Alcocer,M.D., Hsu,P., Wang,T., Eyna,J., Caton,J., Slavkin,H.C. and MacDougall,M. TITLE Timing of the expression of enamel gene products during mouse tooth development JOURNAL Int J Dev Biol 41 (1), 27-38 (1997) PUBMED 9074935 REFERENCE 8 (bases 1 to 1603) AUTHORS Fromm,L. and Overbeek,P.A. TITLE Regulation of cyclin and cyclin-dependent kinase gene expression during lens differentiation requires the retinoblastoma protein JOURNAL Oncogene 12 (1), 69-75 (1996) PUBMED 8552401 REFERENCE 9 (bases 1 to 1603) AUTHORS Sweeney,C., Murphy,M., Kubelka,M., Ravnik,S.E., Hawkins,C.F., Wolgemuth,D.J. and Carrington,M. TITLE A distinct cyclin A is expressed in germ cells in the mouse JOURNAL Development 122 (1), 53-64 (1996) PUBMED 8565853 REFERENCE 10 (bases 1 to 1603) AUTHORS Hirai,H., Roussel,M.F., Kato,J.Y., Ashmun,R.A. and Sherr,C.J. TITLE Novel INK4 proteins, p19 and p18, are specific inhibitors of the cyclin D-dependent kinases CDK4 and CDK6 JOURNAL Mol Cell Biol 15 (5), 2672-2681 (1995) PUBMED 7739547 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC127334.3. On Mar 11, 2024 this sequence version replaced XM_030252400.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR7345562.2369077.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849384, SAMN01164141 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-262 AC127334.3 119877-120138 c 263-448 AC127334.3 118958-119143 c 449-695 AC127334.3 115474-115720 c 696-820 AC127334.3 115171-115295 c 821-1044 AC127334.3 114303-114526 c 1045-1249 AC127334.3 113033-113237 c 1250-1363 AC127334.3 111834-111947 c 1364-1603 AC127334.3 110094-110333 c FEATURES Location/Qualifiers source 1..1603 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="3" /map="3 26.52 cM" gene 1..1603 /gene="Ccna1" /note="cyclin A1" /db_xref="GeneID:12427" /db_xref="MGI:MGI:108042" exon 1..262 /gene="Ccna1" /inference="alignment:Splign:2.1.0" exon 263..448 /gene="Ccna1" /inference="alignment:Splign:2.1.0" misc_feature 278..280 /gene="Ccna1" /note="upstream in-frame stop codon" CDS 284..1480 /gene="Ccna1" /note="isoform 3 is encoded by transcript variant 5" /codon_start=1 /product="cyclin-A1 isoform 3" /protein_id="NP_001415335.1" /db_xref="GeneID:12427" /db_xref="MGI:MGI:108042" /translation="
MHRQSSKSGVALPPVGQGPDACQMLSRAQLGQDPPQRTVLGVLTENEQYRRTCGQEITAIRCFSGSENVFPAAGKKVLSDHGVNEPAKRGFDIYMDDPEQGDRDTCSGKEGIIFEDVYEVDTSMLKSDLHFLLDFNTVSPMLVDPTTHAQSEEATDFGSDVINVTEYAEEIHRYLREAEVRHRPKAHYMRKQPDITEGMRAILVDWLVEVGEEYKLRTETLYLAVNFLDRFLSCMSVLRGKLQLVGTAAILLASKYEEIYPPDVDEFVYITDDTYTKRQLLRMEHLLLKVLAFDLTVPTTNQFLLQYLRRQGVCIRTENLAKYVAELSLLEADPFLKYLPSLVAAAAYCLANYIVNRHFWVPARVPHGAACSSSPAVNGKAHWPHQQACSEVSASGAN"
misc_feature 284..346 /gene="Ccna1" /note="propagated from UniProtKB/Swiss-Prot (Q61456.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 449..695 /gene="Ccna1" /inference="alignment:Splign:2.1.0" exon 696..820 /gene="Ccna1" /inference="alignment:Splign:2.1.0" exon 821..1044 /gene="Ccna1" /inference="alignment:Splign:2.1.0" exon 1045..1249 /gene="Ccna1" /inference="alignment:Splign:2.1.0" exon 1250..1363 /gene="Ccna1" /inference="alignment:Splign:2.1.0" exon 1364..1603 /gene="Ccna1" /inference="alignment:Splign:2.1.0" regulatory 1578..1583 /regulatory_class="polyA_signal_sequence" /gene="Ccna1" /note="hexamer: AATAAA" polyA_site 1603 /gene="Ccna1" /note="major polyA site" ORIGIN
aggagacgttggcgggaggggttcgtagctgttgggggaaccggctcctggggaactgtccctttcagggaggctaccgtgtgtaagccgccgtcagccctccctggtgacatcgaccagaggggtgcaagtggcgacgtgcggtgcagtgcggttcggtgcgcctggcacgcctggctttgcggttcaggagcccggggctgcgcggttggccccgcccggcagcgccccgggggccgagcatcagcgggcagagctgcagcaggctgtggcttactaggcaatgcatcgccagagctccaagagtggagtcgctctgcctccagtgggccaaggtcctgatgcttgtcaaatgctcagcagagctcagcttggccaggatcccccacagagaaccgtgctaggggtgttgactgaaaatgagcagtacaggaggacctgtggccaggagatcacagcaatcagatgtttttctggatcagaaaatgtcttccctgcggctggaaagaaagtgctctctgaccatggggtcaatgaaccagccaaacgtgggtttgatatctatatggatgatcctgaacagggggacagagatacctgctcggggaaagagggcatcatatttgaggatgtgtatgaagtcgacaccagcatgctcaagtcagatctccacttcctgctggatttcaacacagtttccccaatgctggttgaccccaccacccatgcccagtcagaggaagcaacggattttggttcagatgtgattaacgtaacggagtatgcagaggagattcatcgctaccttcgagaagctgaagtaagacacagacccaaggctcactacatgaggaagcagccggacatcacggagggcatgcgcgccatcctggtggactggctggtggaggttggggaagaatataaacttcgcacagagaccctgtacttggctgtcaacttcctggacaggtttctctcctgcatgtctgttctgagagggaaattgcagcttgtcgggacagcagctattctcctggcttcgaaatatgaagagatatatccgcccgacgtggatgagtttgtctacatcaccgacgatacgtacacaaagcgacagctactgaggatggagcatctgctactcaaagtcctggcatttgatctgaccgttccaaccaccaaccaattcctccttcagtacctaaggcgtcaaggagtgtgcatcaggactgagaatttggccaagtatgttgcagaactgagccttctggaagctgacccattcttgaagtatcttccttccttggttgctgcagcagcttactgcctggcaaactatattgtgaacagacacttctgggtacctgcacgtgtccctcatggagccgcctgtagttcttcccctgcagtgaatggcaaagctcattggccacatcagcaggcttgctctgaggtttctgcgagtggggccaactaacgtcagttgtacataacaccttcaacatgagaatgttaggttctcttagatttcagtagtttataatttatatagatatagacaggtattttaaaagaataaacaacttgctgtttggctgtg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]