GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-20 10:30:59, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001428404            1649 bp    mRNA    linear   ROD 15-JUN-2024
DEFINITION  Mus musculus cyclin A1 (Ccna1), transcript variant 3, mRNA.
ACCESSION   NM_001428404 XM_006500949
VERSION     NM_001428404.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1649)
  AUTHORS   Du,X., Zang,C. and Wang,Q.
  TITLE     Cyclin A1 (CCNA1) inhibits osteoporosis by suppressing transforming
            growth factor-beta (TGF-beta) pathway in osteoblasts
  JOURNAL   BMC Musculoskelet Disord 25 (1), 206 (2024)
   PUBMED   38454404
  REMARK    GeneRIF: Cyclin A1 (CCNA1) inhibits osteoporosis by suppressing
            transforming growth factor-beta (TGF-beta) pathway in osteoblasts.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1649)
  AUTHORS   Chong,D., Gu,Y., Zhang,T., Xu,Y., Bu,D., Chen,Z., Xu,N., Li,L.,
            Zhu,X., Wang,H., Li,Y., Zheng,F., Wang,D., Li,P., Xu,L., Hu,Z. and
            Li,C.
  TITLE     Neonatal ketone body elevation regulates postnatal heart
            development by promoting cardiomyocyte mitochondrial maturation and
            metabolic reprogramming
  JOURNAL   Cell Discov 8 (1), 106 (2022)
   PUBMED   36220812
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1649)
  AUTHORS   Gindi,N., Grossman,H., Bar-Joseph,H., Miller,I., Nemerovsky,L.,
            Hadas,R., Nevo,N., Galiani,D., Dekel,N. and Shalgi,R.
  TITLE     Fyn and argonaute 2 participate in maternal-mRNA degradation during
            mouse oocyte maturation
  JOURNAL   Cell Cycle 21 (8), 792-804 (2022)
   PUBMED   35104175
REFERENCE   4  (bases 1 to 1649)
  AUTHORS   Ciemerych,M.A. and Sicinski,P.
  TITLE     Cell cycle in mouse development
  JOURNAL   Oncogene 24 (17), 2877-2898 (2005)
   PUBMED   15838522
  REMARK    Review article
REFERENCE   5  (bases 1 to 1649)
  AUTHORS   Wolgemuth,D.J., Lele,K.M., Jobanputra,V. and Salazar,G.
  TITLE     The A-type cyclins and the meiotic cell cycle in mammalian male
            germ cells
  JOURNAL   Int J Androl 27 (4), 192-199 (2004)
   PUBMED   15271198
  REMARK    Review article
REFERENCE   6  (bases 1 to 1649)
  AUTHORS   Winston,N.
  TITLE     Regulation of early embryo development: functional redundancy
            between cyclin subtypes
  JOURNAL   Reprod Fertil Dev 13 (1), 59-67 (2001)
   PUBMED   11545166
  REMARK    Review article
REFERENCE   7  (bases 1 to 1649)
  AUTHORS   Zeichner-David,M., Vo,H., Tan,H., Diekwisch,T., Berman,B.,
            Thiemann,F., Alcocer,M.D., Hsu,P., Wang,T., Eyna,J., Caton,J.,
            Slavkin,H.C. and MacDougall,M.
  TITLE     Timing of the expression of enamel gene products during mouse tooth
            development
  JOURNAL   Int J Dev Biol 41 (1), 27-38 (1997)
   PUBMED   9074935
REFERENCE   8  (bases 1 to 1649)
  AUTHORS   Fromm,L. and Overbeek,P.A.
  TITLE     Regulation of cyclin and cyclin-dependent kinase gene expression
            during lens differentiation requires the retinoblastoma protein
  JOURNAL   Oncogene 12 (1), 69-75 (1996)
   PUBMED   8552401
REFERENCE   9  (bases 1 to 1649)
  AUTHORS   Sweeney,C., Murphy,M., Kubelka,M., Ravnik,S.E., Hawkins,C.F.,
            Wolgemuth,D.J. and Carrington,M.
  TITLE     A distinct cyclin A is expressed in germ cells in the mouse
  JOURNAL   Development 122 (1), 53-64 (1996)
   PUBMED   8565853
REFERENCE   10 (bases 1 to 1649)
  AUTHORS   Hirai,H., Roussel,M.F., Kato,J.Y., Ashmun,R.A. and Sherr,C.J.
  TITLE     Novel INK4 proteins, p19 and p18, are specific inhibitors of the
            cyclin D-dependent kinases CDK4 and CDK6
  JOURNAL   Mol Cell Biol 15 (5), 2672-2681 (1995)
   PUBMED   7739547
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC127334.3.
            
            On Mar 11, 2024 this sequence version replaced XM_006500949.4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR5189685.182946.1,
                                           SRR14777530.979318.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMN00849374,
                                           SAMN00849376 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-174               AC127334.3         119574-119747       c
            175-360             AC127334.3         118958-119143       c
            361-607             AC127334.3         115474-115720       c
            608-732             AC127334.3         115171-115295       c
            733-956             AC127334.3         114303-114526       c
            957-1161            AC127334.3         113033-113237       c
            1162-1275           AC127334.3         111834-111947       c
            1276-1409           AC127334.3         110592-110725       c
            1410-1649           AC127334.3         110094-110333       c
FEATURES             Location/Qualifiers
     source          1..1649
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="3"
                     /map="3 26.52 cM"
     gene            1..1649
                     /gene="Ccna1"
                     /note="cyclin A1"
                     /db_xref="GeneID:12427"
                     /db_xref="MGI:MGI:108042"
     exon            1..174
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     exon            175..360
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    190..192
                     /gene="Ccna1"
                     /note="upstream in-frame stop codon"
     CDS             196..1461
                     /gene="Ccna1"
                     /note="isoform 1 is encoded by transcript variant 3"
                     /codon_start=1
                     /product="cyclin-A1 isoform 1"
                     /protein_id="NP_001415333.1"
                     /db_xref="GeneID:12427"
                     /db_xref="MGI:MGI:108042"
                     /translation="
MHRQSSKSGVALPPVGQGPDACQMLSRAQLGQDPPQRTVLGVLTENEQYRRTCGQEITAIRCFSGSENVFPAAGKKVLSDHGVNEPAKRGFDIYMDDPEQGDRDTCSGKEGIIFEDVYEVDTSMLKSDLHFLLDFNTVSPMLVDPTTHAQSEEATDFGSDVINVTEYAEEIHRYLREAEVRHRPKAHYMRKQPDITEGMRAILVDWLVEVGEEYKLRTETLYLAVNFLDRFLSCMSVLRGKLQLVGTAAILLASKYEEIYPPDVDEFVYITDDTYTKRQLLRMEHLLLKVLAFDLTVPTTNQFLLQYLRRQGVCIRTENLAKYVAELSLLEADPFLKYLPSLVAAAAYCLANYIVNRHFWPETLAAFTGYSLNEIVPCLSELHKACLSIPHRPQQAIREKYKASKYLHVSLMEPPVVLPLQ"
     misc_feature    196..258
                     /gene="Ccna1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q61456.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            361..607
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     exon            608..732
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     exon            733..956
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     exon            957..1161
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     exon            1162..1275
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     exon            1276..1409
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     exon            1410..1649
                     /gene="Ccna1"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1624..1629
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Ccna1"
                     /note="hexamer: AATAAA"
     polyA_site      1649
                     /gene="Ccna1"
                     /note="major polyA site"
ORIGIN      
agtggcgagcgcactagccgaggctgctggaaccggccccctggaatctctcctctccgggtcccctccctccgcgcacggccccgcccgcccggccccggccggggtgcgcttgctaatcgcccagacagagaagaacctgagaagcagggcctgctgtgggttcccaagcagcaggctgtggcttactaggcaatgcatcgccagagctccaagagtggagtcgctctgcctccagtgggccaaggtcctgatgcttgtcaaatgctcagcagagctcagcttggccaggatcccccacagagaaccgtgctaggggtgttgactgaaaatgagcagtacaggaggacctgtggccaggagatcacagcaatcagatgtttttctggatcagaaaatgtcttccctgcggctggaaagaaagtgctctctgaccatggggtcaatgaaccagccaaacgtgggtttgatatctatatggatgatcctgaacagggggacagagatacctgctcggggaaagagggcatcatatttgaggatgtgtatgaagtcgacaccagcatgctcaagtcagatctccacttcctgctggatttcaacacagtttccccaatgctggttgaccccaccacccatgcccagtcagaggaagcaacggattttggttcagatgtgattaacgtaacggagtatgcagaggagattcatcgctaccttcgagaagctgaagtaagacacagacccaaggctcactacatgaggaagcagccggacatcacggagggcatgcgcgccatcctggtggactggctggtggaggttggggaagaatataaacttcgcacagagaccctgtacttggctgtcaacttcctggacaggtttctctcctgcatgtctgttctgagagggaaattgcagcttgtcgggacagcagctattctcctggcttcgaaatatgaagagatatatccgcccgacgtggatgagtttgtctacatcaccgacgatacgtacacaaagcgacagctactgaggatggagcatctgctactcaaagtcctggcatttgatctgaccgttccaaccaccaaccaattcctccttcagtacctaaggcgtcaaggagtgtgcatcaggactgagaatttggccaagtatgttgcagaactgagccttctggaagctgacccattcttgaagtatcttccttccttggttgctgcagcagcttactgcctggcaaactatattgtgaacagacacttctggccagaaacacttgctgcatttacgggctattcattaaatgagattgtgccttgcctgagtgagctgcataaagcatgcctcagtatcccccatcgaccgcagcaagcaatcagggagaagtacaaggcttcgaagtacctgcacgtgtccctcatggagccgcctgtagttcttcccctgcagtgaatggcaaagctcattggccacatcagcaggcttgctctgaggtttctgcgagtggggccaactaacgtcagttgtacataacaccttcaacatgagaatgttaggttctcttagatttcagtagtttataatttatatagatatagacaggtattttaaaagaataaacaacttgctgtttggctgtg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]