GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-17 16:24:03, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001033335            2213 bp    mRNA    linear   ROD 03-JUN-2024
DEFINITION  Mus musculus serine (or cysteine) peptidase inhibitor, clade A,
            member 3F (Serpina3f), transcript variant 2, mRNA.
ACCESSION   NM_001033335 XM_893682 XM_910175
VERSION     NM_001033335.3
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 2213)
  AUTHORS   Kidoya,H., Naito,H., Muramatsu,F., Yamakawa,D., Jia,W., Ikawa,M.,
            Sonobe,T., Tsuchimochi,H., Shirai,M., Adams,R.H., Fukamizu,A. and
            Takakura,N.
  TITLE     APJ Regulates Parallel Alignment of Arteries and Veins in the Skin
  JOURNAL   Dev Cell 33 (3), 247-259 (2015)
   PUBMED   25920569
REFERENCE   2  (bases 1 to 2213)
  AUTHORS   Heit,C., Jackson,B.C., McAndrews,M., Wright,M.W., Thompson,D.C.,
            Silverman,G.A., Nebert,D.W. and Vasiliou,V.
  TITLE     Update of the human and mouse SERPIN gene superfamily
  JOURNAL   Hum Genomics 7 (1), 22 (2013)
   PUBMED   24172014
  REMARK    Review article
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2213)
  AUTHORS   Archambaud,C., Nahori,M.A., Soubigou,G., Becavin,C., Laval,L.,
            Lechat,P., Smokvina,T., Langella,P., Lecuit,M. and Cossart,P.
  TITLE     Impact of lactobacilli on orally acquired listeriosis
  JOURNAL   Proc Natl Acad Sci U S A 109 (41), 16684-16689 (2012)
   PUBMED   23012479
REFERENCE   4  (bases 1 to 2213)
  AUTHORS   Ghesquiere,B., Van Damme,J., Martens,L., Vandekerckhove,J. and
            Gevaert,K.
  TITLE     Proteome-wide characterization of N-glycosylation events by
            diagonal chromatography
  JOURNAL   J Proteome Res 5 (9), 2438-2447 (2006)
   PUBMED   16944957
REFERENCE   5  (bases 1 to 2213)
  AUTHORS   Winkler,I.G., Hendy,J., Coughlin,P., Horvath,A. and Levesque,J.P.
  TITLE     Serine protease inhibitors serpina1 and serpina3 are down-regulated
            in bone marrow during hematopoietic progenitor mobilization
  JOURNAL   J Exp Med 201 (7), 1077-1088 (2005)
   PUBMED   15795238
REFERENCE   6  (bases 1 to 2213)
  AUTHORS   Horvath,A.J., Forsyth,S.L. and Coughlin,P.B.
  TITLE     Expression patterns of murine antichymotrypsin-like genes reflect
            evolutionary divergence at the Serpina3 locus
  JOURNAL   J Mol Evol 59 (4), 488-497 (2004)
   PUBMED   15638460
REFERENCE   7  (bases 1 to 2213)
  AUTHORS   Forsyth,S., Horvath,A. and Coughlin,P.
  TITLE     A review and comparison of the murine alpha1-antitrypsin and
            alpha1-antichymotrypsin multigene clusters with the human clade A
            serpins
  JOURNAL   Genomics 81 (3), 336-345 (2003)
   PUBMED   12659817
  REMARK    Review article
REFERENCE   8  (bases 1 to 2213)
  AUTHORS   Inglis,J.D. and Hill,R.E.
  TITLE     The murine Spi-2 proteinase inhibitor locus: a multigene family
            with a hypervariable reactive site domain
  JOURNAL   EMBO J 10 (2), 255-261 (1991)
   PUBMED   1991447
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK138954.1, BC139132.1 and AC142112.3.
            
            On Nov 28, 2009 this sequence version replaced NM_001033335.2.
            
            Transcript Variant: This variant (2) differs in the 5' UTR compared
            to variant 1. All three variants encode the same protein.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK138954.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1086              AK138954.1         2-1087
            1087-1996           BC139132.1         976-1885
            1997-2207           AK138954.1         1998-2208
            2208-2213           AC142112.3         76336-76341         c
FEATURES             Location/Qualifiers
     source          1..2213
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="12"
                     /map="12 53.65 cM"
     gene            1..2213
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="serine (or cysteine) peptidase inhibitor, clade A,
                     member 3F"
                     /db_xref="GeneID:238393"
                     /db_xref="MGI:MGI:2182838"
     exon            1..36
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     exon            37..248
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    243..245
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="upstream in-frame stop codon"
     exon            249..867
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     CDS             261..1598
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="antitrypsin; alpha-1 antiproteinasin; serpin A3F"
                     /codon_start=1
                     /product="serine protease inhibitor A3F"
                     /protein_id="NP_001028507.2"
                     /db_xref="CCDS:CCDS26149.1"
                     /db_xref="GeneID:238393"
                     /db_xref="MGI:MGI:2182838"
                     /translation="
MAGVSPAVFGCPDVTLGRNTAVREVQENITSVDSLTLASSNTDFAFSLYKELVLKNPDENVVFSPFSICTALALLSLGAKSNTLKEILEGLKFNLTETPEPDIHQGFRYLLDLLSQPGNQVQISTGSALFIEKHLQILAEFKEKARALYQAEAFTADFQQPLEATKLINDYVSNHTQGKIKELISDLDKRTLMVLVNYIYFKGKWEMPFDPDDTCKSEFYLDENRSVKVPMMKINNLTTPYFRDEELSCTVVELKYTGNASAMFILPDQGKMQQVEASLQPETLRNWKDSLKPRLINELCLPKFSISTDYSLEHILPELGIRELFSTQADLSAITGTKDLRTSQVVHKAVLDVAETGTEAAAGTGYQNLQCCQGVIYSMKIYFDRPFLMIISDTNTHIALFMAKVSNPESDENFLNVEYAFPQVLEIMPEYRSVCTCCLPCLTRQ"
     misc_feature    339..1487
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="serpin family A member 3, alpha 1-antichymotrypsin;
                     Region: serpinA3_A1AC; cd19551"
                     /db_xref="CDD:381019"
     misc_feature    342..344
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site"
     misc_feature    540..542
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site"
     misc_feature    780..782
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:16944957; propagated from
                     UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site"
     misc_feature    1035..1037
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q80X76.3); glycosylation site"
     misc_feature    order(1323..1361,1365..1376,1380..1382,1392..1418)
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="reactive center loop (RCL); other site"
                     /db_xref="CDD:381019"
     misc_feature    1329..1406
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q80X76.3);
                     Region: RCL"
     misc_feature    1371..1376
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="Reactive bond. /evidence=ECO:0000250; propagated
                     from UniProtKB/Swiss-Prot (Q80X76.3); other site"
     exon            868..1141
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     exon            1142..1292
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     exon            1293..2213
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2191..2196
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="hexamer: AATAAA"
     polyA_site      2213
                     /gene="Serpina3f"
                     /gene_synonym="2A1"
                     /note="major polyA site"
ORIGIN      
actttctctctggtgaacagaaggagtcttcactggaaggtttacagcagtcacctgagtccttccagaagacccctcttggaagagaagaattagcactaaaatacaaacagcaccaggaccatccacaacagaactgagctgtcaaagccattggcaagatcttaaaaactaaagaagagaagggaagaacaagctctaggaaaatgagagtggaggaaaagacagcagcttccaaacaatgagcagagaagagagtaatggctggtgtctcccctgctgtctttggctgcccagatgtcaccctgggaaggaacactgcagtccgtgaagtccaagaaaatatcacatcagtggacagtttaacactggcctccagcaacactgactttgccttcagcctctacaaggagctggttttgaagaatccagatgaaaatgttgtcttctccccattcagcatctgcactgccttggccctgctgtccctgggagcaaagagcaacaccctgaaggaaatcctagaaggtctcaagttcaacctcacagagacccctgaaccagacatccaccagggctttaggtacttgctagaccttctcagtcagccagggaaccaggtacagatcagcacaggcagtgccctgtttattgaaaagcacctgcagatcctggcagagttcaaggagaaagcaagggctctgtaccaggctgaggccttcacagcagatttccagcagcctctcgaggccacaaagctcatcaatgactatgtgagcaatcacacccaggggaagatcaaggaactcatttcagacctggataaaaggacattgatggtgctggtgaattacatctactttaaaggcaaatgggagatgccctttgatccggatgatacatgtaagtctgagttctacttggatgagaataggtctgtgaaggtgcccatgatgaaaattaataacctgacgacaccctacttccgggatgaggagctgtcctgcactgtggtggagctgaagtacacaggaaatgccagtgccatgttcatcctcccggaccagggcaagatgcagcaggtggaagccagcttgcaaccagagaccctgaggaattggaaggactctctgaagcccaggttgataaatgagctctgcctgcccaagttctccatctccaccgactacagcctggagcacatccttcctgagctgggcatcagggagctcttctccacccaggctgacctgtctgcaatcacaggaaccaaggatctgagaacttctcaggtggtccacaaggctgtgctggatgtggctgagacaggcacagaagcagctgctggcacaggatatcaaaatctccaatgttgtcaaggtgtaatctactctatgaaaatatatttcgacaggccattcctgatgattatctctgacacaaacactcatattgccctctttatggcaaaagtttcaaatccagagagtgatgagaacttcctaaatgtggagtatgcttttccccaagtgctggaaattatgcctgaatataggtctgtctgcacatgttgccttccatgtctgactagacagtgacactgaccaattctgtcacgtcctcatgcagagaaacaagcctatgactggttattgtcagactccctgtcataatggtagcactaaatcaagttcctgacctgaaatttttgttattccccgtccctgctgtctccactgtatctgcttcaactcaaaagactgggaccgtcagtgaggctctctcctaacttaggctctgcttatgtctgccttcagcttttcagtaatgatgggactatacaagtttacaggccaacccataaggtttaagaagggaacctgcaactgtggtcctatctgcagcatctgaaatgtttggtgcccagttctaccttactcttgccttcctctgggcagagctattctcagtccctgcatagtctcctggccccacccagatctgatacaggtggagccctcacccctgcagctgcatggggctgtgggtcagggtagttcttctacccctagcactcctaatcaggacagagaagtcgcctaaccctaagtgtctagttgaccaaccacacaagacagatggacacctccaccttcatcacacaaattgaaagggcaggagctaaggatcaataaacatgtaactgcattgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]