GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-15 04:26:45, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001001877            1058 bp    mRNA    linear   PRI 30-APR-2025
DEFINITION  Homo sapiens heat shock transcription factor Y-linked 2 (HSFY2),
            transcript variant 2, mRNA.
ACCESSION   NM_001001877
VERSION     NM_001001877.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1058)
  AUTHORS   Haenig,C., Atias,N., Taylor,A.K., Mazza,A., Schaefer,M.H., Russ,J.,
            Riechers,S.P., Jain,S., Coughlin,M., Fontaine,J.F., Freibaum,B.D.,
            Brusendorf,L., Zenkner,M., Porras,P., Stroedicke,M., Schnoegl,S.,
            Arnsburg,K., Boeddrich,A., Pigazzini,L., Heutink,P., Taylor,J.P.,
            Kirstein,J., Andrade-Navarro,M.A., Sharan,R. and Wanker,E.E.
  TITLE     Interactome Mapping Provides a Network of Neurodegenerative Disease
            Proteins and Uncovers Widespread Protein Aggregation in Affected
            Brains
  JOURNAL   Cell Rep 32 (7), 108050 (2020)
   PUBMED   32814053
REFERENCE   2  (bases 1 to 1058)
  AUTHORS   Luck,K., Kim,D.K., Lambourne,L., Spirohn,K., Begg,B.E., Bian,W.,
            Brignall,R., Cafarelli,T., Campos-Laborie,F.J., Charloteaux,B.,
            Choi,D., Cote,A.G., Daley,M., Deimling,S., Desbuleux,A., Dricot,A.,
            Gebbia,M., Hardy,M.F., Kishore,N., Knapp,J.J., Kovacs,I.A.,
            Lemmens,I., Mee,M.W., Mellor,J.C., Pollis,C., Pons,C.,
            Richardson,A.D., Schlabach,S., Teeking,B., Yadav,A., Babor,M.,
            Balcha,D., Basha,O., Bowman-Colin,C., Chin,S.F., Choi,S.G.,
            Colabella,C., Coppin,G., D'Amata,C., De Ridder,D., De Rouck,S.,
            Duran-Frigola,M., Ennajdaoui,H., Goebels,F., Goehring,L., Gopal,A.,
            Haddad,G., Hatchi,E., Helmy,M., Jacob,Y., Kassa,Y., Landini,S.,
            Li,R., van Lieshout,N., MacWilliams,A., Markey,D., Paulson,J.N.,
            Rangarajan,S., Rasla,J., Rayhan,A., Rolland,T., San-Miguel,A.,
            Shen,Y., Sheykhkarimli,D., Sheynkman,G.M., Simonovsky,E., Tasan,M.,
            Tejeda,A., Tropepe,V., Twizere,J.C., Wang,Y., Weatheritt,R.J.,
            Weile,J., Xia,Y., Yang,X., Yeger-Lotem,E., Zhong,Q., Aloy,P.,
            Bader,G.D., De Las Rivas,J., Gaudet,S., Hao,T., Rak,J.,
            Tavernier,J., Hill,D.E., Vidal,M., Roth,F.P. and Calderwood,M.A.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   3  (bases 1 to 1058)
  AUTHORS   Fragoza,R., Das,J., Wierbowski,S.D., Liang,J., Tran,T.N., Liang,S.,
            Beltran,J.F., Rivera-Erick,C.A., Ye,K., Wang,T.Y., Yao,L., Mort,M.,
            Stenson,P.D., Cooper,D.N., Wei,X., Keinan,A., Schimenti,J.C.,
            Clark,A.G. and Yu,H.
  TITLE     Extensive disruption of protein interactions by genetic variants
            across the allele frequency spectrum in human populations
  JOURNAL   Nat Commun 10 (1), 4141 (2019)
   PUBMED   31515488
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1058)
  AUTHORS   Chen,S., Fragoza,R., Klei,L., Liu,Y., Wang,J., Roeder,K., Devlin,B.
            and Yu,H.
  TITLE     An interactome perturbation framework prioritizes damaging missense
            mutations for developmental disorders
  JOURNAL   Nat Genet 50 (7), 1032-1040 (2018)
   PUBMED   29892012
REFERENCE   5  (bases 1 to 1058)
  AUTHORS   Yin,Y., Morgunova,E., Jolma,A., Kaasinen,E., Sahu,B.,
            Khund-Sayeed,S., Das,P.K., Kivioja,T., Dave,K., Zhong,F.,
            Nitta,K.R., Taipale,M., Popov,A., Ginno,P.A., Domcke,S., Yan,J.,
            Schubeler,D., Vinson,C. and Taipale,J.
  TITLE     Impact of cytosine methylation on DNA binding specificities of
            human transcription factors
  JOURNAL   Science 356 (6337) (2017)
   PUBMED   28473536
REFERENCE   6  (bases 1 to 1058)
  AUTHORS   Corominas,R., Yang,X., Lin,G.N., Kang,S., Shen,Y., Ghamsari,L.,
            Broly,M., Rodriguez,M., Tam,S., Wanamaker,S.A., Fan,C., Yi,S.,
            Tasan,M., Lemmens,I., Kuang,X., Zhao,N., Malhotra,D.,
            Michaelson,J.J., Vacic,V., Calderwood,M.A., Roth,F.P.,
            Tavernier,J., Horvath,S., Salehi-Ashtiani,K., Korkin,D., Sebat,J.,
            Hill,D.E., Hao,T., Vidal,M. and Iakoucheva,L.M.
  TITLE     Protein interaction network of alternatively spliced isoforms from
            brain links genetic risk factors for autism
  JOURNAL   Nat Commun 5, 3650 (2014)
   PUBMED   24722188
  REMARK    Erratum:[Nat Commun. 2023 Feb 2;14(1):569. doi:
            10.1038/s41467-023-36264-y. PMID: 36732511]
            Publication Status: Online-Only
REFERENCE   7  (bases 1 to 1058)
  AUTHORS   Vaquerizas,J.M., Kummerfeld,S.K., Teichmann,S.A. and Luscombe,N.M.
  TITLE     A census of human transcription factors: function, expression and
            evolution
  JOURNAL   Nat Rev Genet 10 (4), 252-263 (2009)
   PUBMED   19274049
  REMARK    Review article
REFERENCE   8  (bases 1 to 1058)
  AUTHORS   Shinka,T., Sato,Y., Chen,G., Naroda,T., Kinoshita,K., Unemi,Y.,
            Tsuji,K., Toida,K., Iwamoto,T. and Nakahori,Y.
  TITLE     Molecular characterization of heat shock-like factor encoded on the
            human Y chromosome, and implications for male infertility
  JOURNAL   Biol Reprod 71 (1), 297-306 (2004)
   PUBMED   15044259
REFERENCE   9  (bases 1 to 1058)
  AUTHORS   Tessari,A., Salata,E., Ferlin,A., Bartoloni,L., Slongo,M.L. and
            Foresta,C.
  TITLE     Characterization of HSFY, a novel AZFb gene on the Y chromosome
            with a possible role in human spermatogenesis
  JOURNAL   Mol Hum Reprod 10 (4), 253-258 (2004)
   PUBMED   14985478
  REMARK    GeneRIF: Could have an important role in human spermatogenesis.
REFERENCE   10 (bases 1 to 1058)
  AUTHORS   Skaletsky,H., Kuroda-Kawaguchi,T., Minx,P.J., Cordum,H.S.,
            Hillier,L., Brown,L.G., Repping,S., Pyntikova,T., Ali,J., Bieri,T.,
            Chinwalla,A., Delehaunty,A., Delehaunty,K., Du,H., Fewell,G.,
            Fulton,L., Fulton,R., Graves,T., Hou,S.F., Latrielle,P.,
            Leonard,S., Mardis,E., Maupin,R., McPherson,J., Miner,T., Nash,W.,
            Nguyen,C., Ozersky,P., Pepin,K., Rock,S., Rohlfing,T., Scott,K.,
            Schultz,B., Strong,C., Tin-Wollam,A., Yang,S.P., Waterston,R.H.,
            Wilson,R.K., Rozen,S. and Page,D.C.
  TITLE     The male-specific region of the human Y chromosome is a mosaic of
            discrete sequence classes
  JOURNAL   Nature 423 (6942), 825-837 (2003)
   PUBMED   12815422
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC007379.2.
            
            On Aug 13, 2020 this sequence version replaced NM_001001877.1.
            
            Summary: This gene encodes a member of the heat shock factor (HSF)
            family of transcriptional activators for heat shock proteins. This
            gene is a candidate gene for azoospermia, since it localizes to a
            region of chromosome Y that is sometimes deleted in infertile
            males. The genome has two identical copies of this gene within a
            palindromic region; this record represents the more telomeric copy.
            Alternative splicing results in multiple transcript variants
            encoding distinct isoforms. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) includes a different exon in
            the 3' coding region, resulting in a frameshift and earlier
            termination codon, compared to variant 1. The resulting isoform (2)
            is shorter and has a distinct C-terminus compared to isoform 1.
            Isoform 2 lacks the HFS-type DNA-binding domain found in isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AI798750.1, AI221709.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2151119
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-20                AC007379.2         104620-104639       c
            21-630              AC007379.2         104010-104619       c
            631-1058            AC007379.2         62344-62771         c
FEATURES             Location/Qualifiers
     source          1..1058
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="Y"
                     /map="Yq11.222"
     gene            1..1058
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="heat shock transcription factor Y-linked 2"
                     /db_xref="GeneID:159119"
                     /db_xref="HGNC:HGNC:23950"
     exon            1..630
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    94..96
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="upstream in-frame stop codon"
     CDS             118..729
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="isoform 2 is encoded by transcript variant 2; heat
                     shock transcription factor 2-like protein"
                     /codon_start=1
                     /product="heat shock transcription factor, Y-linked
                     isoform 2"
                     /protein_id="NP_001001877.1"
                     /db_xref="CCDS:CCDS35476.1"
                     /db_xref="GeneID:159119"
                     /db_xref="HGNC:HGNC:23950"
                     /translation="
MAHVSSETQDVSPKDELTASEASTRSPLCEHTFPGDSDLRSMIEEHAFQVLSQGSLLESPSYTVCVSEPDKDDDFLSLNFPRKLWKIVESDQFKSISWDENGTCIVINEELFKKEILETKAPYRIFQTDAIKSFVRQLNLYGFSKIQQNFQRSAFLATFLSEEKESSVLSKIRFTKMKLSRSSTYENRYLCCNLHLKDESNYS"
     misc_feature    118..207
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96LI6.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    355..>576
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="HSF-type DNA-binding; Region: HSF_DNA-bind;
                     pfam00447"
                     /db_xref="CDD:459813"
     variation       425
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2520889123"
     exon            631..1058
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /inference="alignment:Splign:2.1.0"
     variation       920..929
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:2520887345"
ORIGIN      
aaccattgtgatggtctagataagtgtacatgcttaggccttctgaagcagcatttgaagctgcagtcctgaaaaccatgcaggccggaagagtagataaagaaatatttatttgagatggcacatgtttcttcagaaactcaagatgtttcccccaaagatgaattaactgcttcagaagcctccactaggtctccattgtgtgaacacaccttccctggggactcagacttacggtcaatgattgaagaacatgcttttcaggttttgtcacaaggatccttgttagaaagtccaagttacacagtttgtgtctctgagccagataaagatgatgattttctttctctgaactttcccaggaaactttggaaaatagtggaaagtgaccaattcaagtctatttcatgggatgagaatggaacttgcatagtgattaatgaagaactcttcaagaaagaaattttggaaacaaaggctccttacagaatatttcaaactgatgctatcaaaagttttgttcgacagctcaacctttatggatttagtaaaattcaacagaattttcaaagatctgcctttctagccacctttctgtcagaagagaaagaatcgtctgtcttaagcaagatacgcttcaccaaaatgaaactttccagatcttcaacttatgaaaacaggtatttatgttgcaacttacatttaaaagatgagtcgaattactcataatccttagaagttagcttgtccgcatctgaaaattcacttttaccttgaagttcaatctgtctctgggaaagactagattggaagaataaaattcaagaatgtgatgttttagtaatggaaaagccaagagcgtcaggtggcaaaagtccttctgttactcaagaaaatgctctgaaaaattccttttctcttttttttttgtaaagattaactccacctcaccaccacaatgaggtatttttctcagcaattgacacctgtttactcagttactccctgtaactatgttatgctgtgaagtaggcaatacagttgttaaagaagaataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]