2024-07-03 21:51:53, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS XR_005857750 1209 bp RNA linear VRT 01-MAR-2022 DEFINITION PREDICTED: Gallus gallus uncharacterized LOC121109953 (LOC121109953), ncRNA. ACCESSION XR_005857750 VERSION XR_005857750.2 DBLINK BioProject: PRJNA698609 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_052533.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Mar 1, 2022 this sequence version replaced XR_005857750.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gallus gallus Annotation Release 106 Annotation Version :: 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1209 /organism="Gallus gallus" /mol_type="transcribed RNA" /isolate="bGalGal1" /db_xref="taxon:9031" /chromosome="2" /sex="female" /tissue_type="blood" /country="USA: Fayetteville" /lat_lon="36.0822 N 94.1719 W" /collection_date="20-May-2019" /collected_by="Nick Anthony" gene 1..1209 /gene="LOC121109953" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 long SRA read, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="CGNC:89819" /db_xref="GeneID:121109953" ncRNA 1..1209 /ncRNA_class="lncRNA" /gene="LOC121109953" /product="uncharacterized LOC121109953" /db_xref="GeneID:121109953" /db_xref="CGNC:89819" ORIGIN
aggtcataatgacctccattcctgttggacatcctgctatttgtgggttagacttggacttcggccacatttaatagcccctcctggatcaccccccttagacaaggtcagcctgagcctgctttgggcataccctggggaagatatggattcctgcaatgttttggactgtgagtacatcaggatgaagagtctgtgttggtgtttgtggtgtacaggcttctgattcaggtattcctgctgtgttacacaatagctgtctcatgcagcaagcactagagaactacagcagatgaagtgcttggtgacatgaaggaacaagcagatctatgaacagtggaaacaatacaacaagttttccgacgtatttgtgccacctagtagtctcctttaacatctaacagcatgagtggggaatcaaatcttctgccactgctgggatactcacagcatcgctccactgggcataatatggtgtctaataaagaattaacagaacagcttgcttctcagttgggtgcacacataagctgcatctacactactaaattaaacaatactagggaacgtttccaagcactggaacttgatcaactattcagttaaattgtgagaatactagctggcatggttctgaccagagaaaactagcactttcttaaacagttcccaggaactacttaaaagttagaaaatgccaaggcccatcaaaataggcatttggacatggccacccttcttggaagggtaagagagtttaatagtacggaatctttgtttggtgccagttggcttcaggagcacagaacagtactaggcatgtttagctcgctactatagatgtagccatagcctatttttgctccacccagtttctgattttcataacagttgtgggaataaaatgtctttgaaatgacccagggttttttttgtttgttttgtttttctttaatgttggattgaactgactgacagaacgatgcacacccacatccgtaagcatctacctaccagcatacacacacacccatatgtacacatagaacatgaccatgcatatacacctgtacatacacatacttaaatacatatatgcaattaaagaactggagcatgtaaatatcatttcttcagtataatgtcttgcaaaaatttacaaaatcttgccacagctccctcgagatatacgtttgaggagaatttccc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]