2025-09-18 08:49:56, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_015294131 2025 bp mRNA linear VRT 01-MAR-2022 DEFINITION PREDICTED: Gallus gallus eukaryotic translation initiation factor 2 alpha kinase 1 (EIF2AK1), transcript variant X5, mRNA. ACCESSION XM_015294131 VERSION XM_015294131.4 DBLINK BioProject: PRJNA698609 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_052545.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 1, 2022 this sequence version replaced XM_015294131.3. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gallus gallus Annotation Release 106 Annotation Version :: 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2025 /organism="Gallus gallus" /mol_type="mRNA" /isolate="bGalGal1" /db_xref="taxon:9031" /chromosome="14" /sex="female" /tissue_type="blood" /geo_loc_name="USA: Fayetteville" /lat_lon="36.0822 N 94.1719 W" /collection_date="20-May-2019" /collected_by="Nick Anthony" gene 1..2025 /gene="EIF2AK1" /note="eukaryotic translation initiation factor 2 alpha kinase 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 mRNAs, 9 ESTs, 205 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 92 samples with support for all annotated introns" /db_xref="CGNC:2470" /db_xref="GeneID:395360" misc_feature 1 /gene="EIF2AK1" /experiment="COORDINATES: cap analysis [ECO:0007248]" /note="transcription start site" CDS 403..1950 /gene="EIF2AK1" /codon_start=1 /product="eukaryotic translation initiation factor 2-alpha kinase 1 isoform X5" /protein_id="XP_015149617.2" /db_xref="GeneID:395360" /db_xref="CGNC:2470" /translation="
MKAANRQVLNGELDNGDSRAIGEKEVLLEAQTSRYLNEFDEIARLGKGGYGQVYKVRNKLDGQFYAIKKINIKKATRRDCMKVLREVKVLAGLQHPNIVGYHTAWMEHVQTACPKDKTVLKLQSLPLEQESGDDHCHIQSVESGSSIIFADLTSQEEKSGDSTCLRNPDGESVQNMDVRNDFTNSNSKEICMKPNRCELPIELQEDSDSSVDCRSTDLKHDSSYDPPCSLDLDASAGSKSCTEECSGNDVALCGEFEVEYRLMLYIQMQLCELSLWDWIAARNKRCNERTEDAAGLYHLVDVSWTMKIFEELLEGVCYIHSMGVMHRDIKPRNIFLHGSDHQVKIGDFGLACKDLLWDDADQWFHTERINGLTHTSGVGTCLYASPEQLQGSDYDFKSDMYSLGVILLELFQPFGTEMERAEVITNLRNGHIPHNFCKKWPVQAKYVKLLTSQVSTERPTAAQLRESELFHTTEHVISNLQQKVREQEEEIEKLKEKLRLLSTGQDEHMKQGSPV"
misc_feature 496..1806 /gene="EIF2AK1" /note="Catalytic domain of the Serine/Threonine kinase, eukaryotic translation Initiation Factor 2-Alpha Kinase 2 or Heme-Regulated Inhibitor kinase; Region: STKc_EIF2AK1_HRI; cd14049" /db_xref="CDD:270951" misc_feature order(496..504,511..516,652..657,664..669,673..678, 700..726,730..732,1192..1194,1354..1356,1363..1371) /gene="EIF2AK1" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:270951" misc_feature 514..>1083 /gene="EIF2AK1" /note="The protein kinase superfamily is mainly composed of the catalytic domains of serine/threonine-specific and tyrosine-specific protein kinases. It also includes RIO kinases, which are atypical serine protein kinases, aminoglycoside phosphotransferases; Region: Protein Kinases, catalytic domain; cl21453" /db_xref="CDD:473864" misc_feature order(535..540,553..555,559..561,598..600,604..606, 1204..1215,1222..1224,1396..1401,1405..1407,1441..1443, 1540..1548,1639..1641,1645..1668) /gene="EIF2AK1" /note="active site" /db_xref="CDD:270951" misc_feature order(535..540,553..555,559..561,598..600,604..606, 697..699,1204..1215,1222..1224,1384..1386,1390..1392, 1396..1401,1405..1407,1441..1443) /gene="EIF2AK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270951" misc_feature order(535..546,553..555,559..561,598..600,604..606, 697..699,820..822,823..825,931..933,940..942,946..948, 1048..1053) /gene="EIF2AK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature order(1438..1467,1513..1548) /gene="EIF2AK1" /note="activation loop (A-loop); other site" /db_xref="CDD:270951" misc_feature order(1540..1548,1639..1641,1645..1668) /gene="EIF2AK1" /note="eIF2alpha (substrate) binding site [polypeptide binding]; other site" /db_xref="CDD:270951" polyA_site 2025 /gene="EIF2AK1" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
gtacagaggcgggcaggtgccggcggcgggggaaggccgcgagcgcagcgccgggcatgtggcggggtcgggaggtgccccccagggccgcggcccatcgcccgccgcccgccatccaattccctgaggagagcccggagccgcgcttcgacgagtcggacgtgccggcagaactgcgagtggccaatgggtcacagaagtttgtgaatttcacttcgaccatccagaaccagctgctgctggtgtcgctgctggagcacctgtgccacatgtacacacacaacctcgtgcactcgagtacttcgacaggctttcacgagaacaggtttgctctccccttttgccttctgtgatgaatttagtactgtaagactgcagcataatagagccattactgagctaatgaaagcagctaaccgacaagtgcttaatggggagcttgataatggagattctcgtgcaattggggaaaaagaagttctcttggaagcacagacatcacgatacttgaatgaatttgatgagattgcaagattaggaaaaggaggatatggccaagtatacaaggtcagaaacaagttagatggtcagttctatgctattaaaaaaatcaatattaagaaggctacaagaagagattgcatgaaggtgctacgagaggttaaagtgctggctggactgcagcatcctaatattgtgggctatcacactgcttggatggaacacgttcaaacagcttgcccaaaagataagacagtattgaagttgcagtcattacccttggaacaggagagtggagatgatcactgtcacattcagagtgtggaaagtggtagttcaattatttttgctgaccttacttcacaagaagaaaagtctggtgacagtacatgtcttagaaatccagatggtgaatcagtgcagaatatggatgtaaggaatgatttcactaacagcaatagtaaggaaatatgtatgaaaccaaatagatgtgaattacccatagaactacaagaagactctgacagtagtgttgactgtagatcaactgatttaaaacatgattcatcgtacgacccaccctgtagtctggatctagatgctagtgctggaagcaagtcctgcactgaagagtgctctgggaatgatgtagctctctgtggagagtttgaggtggagtatcgtttgatgctttatatacagatgcaactgtgtgaactgtccctgtgggactggattgctgcccgtaacaaaagatgcaatgagagaacagaggatgctgctggtctgtaccaccttgtggatgtcagctggacaatgaaaatttttgaagagttattagaaggagtgtgctatatccacagcatgggagtgatgcatcgagacattaaacccagaaatatctttttgcatggatcagatcatcaagttaaaataggagattttggattagcctgcaaagacctcctttgggatgatgcagaccagtggtttcacacagaaaggataaatggactgacacatacctcaggtgtggggacttgcctgtatgcttcaccagaacagctgcaggggtctgactacgacttcaagtcagacatgtacagcttgggtgttatcctgctagaactcttccagccatttggaacagaaatggaaagagcagaagttataacaaatttaaggaatggccacattcctcataacttctgcaagaaatggcctgttcaagccaagtatgtaaaacttctcaccagtcaggtatccacagaaagaccaactgctgctcaacttcgtgaaagtgagctgtttcataccacagaacatgttatttctaatctacagcaaaaggtgagagagcaagaagaagaaatagaaaaactgaaagagaaactaagactgctttctactggacaagatgaacatatgaaacaaggttctccggtttaagtacaggaagaacacaactattgtatattaagttatagaaaacagggtttttttacataaaaatagttcagtgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]