GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-01 07:12:07, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_015294131            2025 bp    mRNA    linear   VRT 01-MAR-2022
DEFINITION  PREDICTED: Gallus gallus eukaryotic translation initiation factor 2
            alpha kinase 1 (EIF2AK1), transcript variant X5, mRNA.
ACCESSION   XM_015294131
VERSION     XM_015294131.4
DBLINK      BioProject: PRJNA698609
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_052545.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 1, 2022 this sequence version replaced XM_015294131.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gallus gallus Annotation Release 106
            Annotation Version          :: 106
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2025
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /isolate="bGalGal1"
                     /db_xref="taxon:9031"
                     /chromosome="14"
                     /sex="female"
                     /tissue_type="blood"
                     /geo_loc_name="USA: Fayetteville"
                     /lat_lon="36.0822 N 94.1719 W"
                     /collection_date="20-May-2019"
                     /collected_by="Nick Anthony"
     gene            1..2025
                     /gene="EIF2AK1"
                     /note="eukaryotic translation initiation factor 2 alpha
                     kinase 1; Derived by automated computational analysis
                     using gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 7 mRNAs, 9 ESTs, 205 long SRA
                     reads, and 100% coverage of the annotated genomic feature
                     by RNAseq alignments, including 92 samples with support
                     for all annotated introns"
                     /db_xref="CGNC:2470"
                     /db_xref="GeneID:395360"
     misc_feature    1
                     /gene="EIF2AK1"
                     /experiment="COORDINATES: cap analysis [ECO:0007248]"
                     /note="transcription start site"
     CDS             403..1950
                     /gene="EIF2AK1"
                     /codon_start=1
                     /product="eukaryotic translation initiation factor 2-alpha
                     kinase 1 isoform X5"
                     /protein_id="XP_015149617.2"
                     /db_xref="GeneID:395360"
                     /db_xref="CGNC:2470"
                     /translation="
MKAANRQVLNGELDNGDSRAIGEKEVLLEAQTSRYLNEFDEIARLGKGGYGQVYKVRNKLDGQFYAIKKINIKKATRRDCMKVLREVKVLAGLQHPNIVGYHTAWMEHVQTACPKDKTVLKLQSLPLEQESGDDHCHIQSVESGSSIIFADLTSQEEKSGDSTCLRNPDGESVQNMDVRNDFTNSNSKEICMKPNRCELPIELQEDSDSSVDCRSTDLKHDSSYDPPCSLDLDASAGSKSCTEECSGNDVALCGEFEVEYRLMLYIQMQLCELSLWDWIAARNKRCNERTEDAAGLYHLVDVSWTMKIFEELLEGVCYIHSMGVMHRDIKPRNIFLHGSDHQVKIGDFGLACKDLLWDDADQWFHTERINGLTHTSGVGTCLYASPEQLQGSDYDFKSDMYSLGVILLELFQPFGTEMERAEVITNLRNGHIPHNFCKKWPVQAKYVKLLTSQVSTERPTAAQLRESELFHTTEHVISNLQQKVREQEEEIEKLKEKLRLLSTGQDEHMKQGSPV"
     misc_feature    496..1806
                     /gene="EIF2AK1"
                     /note="Catalytic domain of the Serine/Threonine kinase,
                     eukaryotic translation Initiation Factor 2-Alpha Kinase 2
                     or Heme-Regulated Inhibitor kinase; Region:
                     STKc_EIF2AK1_HRI; cd14049"
                     /db_xref="CDD:270951"
     misc_feature    order(496..504,511..516,652..657,664..669,673..678,
                     700..726,730..732,1192..1194,1354..1356,1363..1371)
                     /gene="EIF2AK1"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:270951"
     misc_feature    514..>1083
                     /gene="EIF2AK1"
                     /note="The protein kinase superfamily is mainly composed
                     of the catalytic domains of serine/threonine-specific and
                     tyrosine-specific protein kinases. It also includes RIO
                     kinases, which are atypical serine protein kinases,
                     aminoglycoside phosphotransferases; Region: Protein
                     Kinases, catalytic domain; cl21453"
                     /db_xref="CDD:473864"
     misc_feature    order(535..540,553..555,559..561,598..600,604..606,
                     1204..1215,1222..1224,1396..1401,1405..1407,1441..1443,
                     1540..1548,1639..1641,1645..1668)
                     /gene="EIF2AK1"
                     /note="active site"
                     /db_xref="CDD:270951"
     misc_feature    order(535..540,553..555,559..561,598..600,604..606,
                     697..699,1204..1215,1222..1224,1384..1386,1390..1392,
                     1396..1401,1405..1407,1441..1443)
                     /gene="EIF2AK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270951"
     misc_feature    order(535..546,553..555,559..561,598..600,604..606,
                     697..699,820..822,823..825,931..933,940..942,946..948,
                     1048..1053)
                     /gene="EIF2AK1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(1438..1467,1513..1548)
                     /gene="EIF2AK1"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270951"
     misc_feature    order(1540..1548,1639..1641,1645..1668)
                     /gene="EIF2AK1"
                     /note="eIF2alpha (substrate) binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270951"
     polyA_site      2025
                     /gene="EIF2AK1"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gtacagaggcgggcaggtgccggcggcgggggaaggccgcgagcgcagcgccgggcatgtggcggggtcgggaggtgccccccagggccgcggcccatcgcccgccgcccgccatccaattccctgaggagagcccggagccgcgcttcgacgagtcggacgtgccggcagaactgcgagtggccaatgggtcacagaagtttgtgaatttcacttcgaccatccagaaccagctgctgctggtgtcgctgctggagcacctgtgccacatgtacacacacaacctcgtgcactcgagtacttcgacaggctttcacgagaacaggtttgctctccccttttgccttctgtgatgaatttagtactgtaagactgcagcataatagagccattactgagctaatgaaagcagctaaccgacaagtgcttaatggggagcttgataatggagattctcgtgcaattggggaaaaagaagttctcttggaagcacagacatcacgatacttgaatgaatttgatgagattgcaagattaggaaaaggaggatatggccaagtatacaaggtcagaaacaagttagatggtcagttctatgctattaaaaaaatcaatattaagaaggctacaagaagagattgcatgaaggtgctacgagaggttaaagtgctggctggactgcagcatcctaatattgtgggctatcacactgcttggatggaacacgttcaaacagcttgcccaaaagataagacagtattgaagttgcagtcattacccttggaacaggagagtggagatgatcactgtcacattcagagtgtggaaagtggtagttcaattatttttgctgaccttacttcacaagaagaaaagtctggtgacagtacatgtcttagaaatccagatggtgaatcagtgcagaatatggatgtaaggaatgatttcactaacagcaatagtaaggaaatatgtatgaaaccaaatagatgtgaattacccatagaactacaagaagactctgacagtagtgttgactgtagatcaactgatttaaaacatgattcatcgtacgacccaccctgtagtctggatctagatgctagtgctggaagcaagtcctgcactgaagagtgctctgggaatgatgtagctctctgtggagagtttgaggtggagtatcgtttgatgctttatatacagatgcaactgtgtgaactgtccctgtgggactggattgctgcccgtaacaaaagatgcaatgagagaacagaggatgctgctggtctgtaccaccttgtggatgtcagctggacaatgaaaatttttgaagagttattagaaggagtgtgctatatccacagcatgggagtgatgcatcgagacattaaacccagaaatatctttttgcatggatcagatcatcaagttaaaataggagattttggattagcctgcaaagacctcctttgggatgatgcagaccagtggtttcacacagaaaggataaatggactgacacatacctcaggtgtggggacttgcctgtatgcttcaccagaacagctgcaggggtctgactacgacttcaagtcagacatgtacagcttgggtgttatcctgctagaactcttccagccatttggaacagaaatggaaagagcagaagttataacaaatttaaggaatggccacattcctcataacttctgcaagaaatggcctgttcaagccaagtatgtaaaacttctcaccagtcaggtatccacagaaagaccaactgctgctcaacttcgtgaaagtgagctgtttcataccacagaacatgttatttctaatctacagcaaaaggtgagagagcaagaagaagaaatagaaaaactgaaagagaaactaagactgctttctactggacaagatgaacatatgaaacaaggttctccggtttaagtacaggaagaacacaactattgtatattaagttatagaaaacagggtttttttacataaaaatagttcagtgca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]