GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-17 20:55:47, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NM_205533               1018 bp    mRNA    linear   VRT 30-APR-2025
DEFINITION  Gallus gallus H6 family homeobox 1 (HMX1), mRNA.
ACCESSION   NM_205533
VERSION     NM_205533.3
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1018)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1018)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1018)
  AUTHORS   Schulte,D. and Cepko,C.L.
  TITLE     Two homeobox genes define the domain of EphA3 expression in the
            developing chick retina
  JOURNAL   Development 127 (23), 5033-5045 (2000)
   PUBMED   11060230
REFERENCE   4  (bases 1 to 1018)
  AUTHORS   Stadler,H.S., Murray,J.C., Leysens,N.J., Goodfellow,P.J. and
            Solursh,M.
  TITLE     Phylogenetic conservation and physical mapping of members of the H6
            homeobox gene family
  JOURNAL   Mamm Genome 6 (6), 383-388 (1995)
   PUBMED   7647458
REFERENCE   5  (bases 1 to 1018)
  AUTHORS   Stadler,H.S. and Solursh,M.
  TITLE     Characterization of the homeobox-containing gene GH6 identifies
            novel regions of homeobox gene expression in the developing chick
            embryo
  JOURNAL   Dev Biol 161 (1), 251-262 (1994)
   PUBMED   7904968
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000074.1.
            
            On Dec 3, 2021 this sequence version replaced NM_205533.2.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR13267649.35278.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3109051, SAMEA3109053
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-327               JAENSK010000074.1  33954095-33954421   c
            328-1018            JAENSK010000074.1  33951761-33952451   c
FEATURES             Location/Qualifiers
     source          1..1018
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="4"
                     /map="4"
     gene            1..1018
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /note="H6 family homeobox 1"
                     /db_xref="CGNC:11629"
                     /db_xref="GeneID:396546"
     exon            1..327
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /inference="alignment:Splign:2.1.0"
     CDS             78..899
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /note="homeo box (H6 family) 1; homeobox protein H6;
                     homeobox (H6 family) 1"
                     /codon_start=1
                     /product="homeobox protein HMX1"
                     /protein_id="NP_990864.2"
                     /db_xref="CGNC:11629"
                     /db_xref="GeneID:396546"
                     /translation="
MPDEATENAGSTSARVSSFFIEDLLGTEGGGGTRRAAAGGGGGRGAPRCGPHSPLRLGASGCPLRDAAVGWYRRAFLGCASPDTSDRDSPELPEDTERAGGGGRAAARGPAGGRQSSGGREEEEERGEEAGEAEQRAAGRKKKTRTVFSRSQVFQLESTFDVKRYLSSSERAGLAASLHLTETQVKIWFQNRRNKWKRQLAADLEAANLSHAAQRIVRVPILYHENSPASALGFGLPHMSPPLVGFSGGVSYPLGTFPAASLPFLRSQMTGLV"
     misc_feature    501..671
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     exon            328..1018
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ccgcggggcagcggggagccgaggagccatcctccggcggagccgggaccccccctcccgcagctgttttaccgacgatgccggacgaagcgacggaaaacgccggctccacatctgcccgcgtctcgtcctttttcatcgaggacctgctgggcaccgaaggcggcggagggacgcggagggcggcggcgggaggcggaggtgggcgcggagctccgcgctgcggcccccactccccgctgcgcctcggagcctcgggctgcccgctccgcgacgccgccgtcggttggtaccgtcgagctttcttgggctgcgccagccccgacaccagcgaccgggactcgccggagctgcccgaggacacggagcgggcgggcggcggcgggcgggcggcggcgcggggccccgcgggcgggaggcagagctccggaggccgcgaggaagaggaggaacgcggcgaggaagcgggcgaagcggagcagcgagccgccggccgcaagaagaagacgcgcacggtgttcagccgcagccaggtcttccagctggagtccaccttcgacgtgaagcgctacctgagcagctccgagagggccggcctggccgcctcgctgcacctcaccgagacgcaggtgaagatttggttccagaaccgccgcaacaagtggaagcggcagctcgccgccgacctggaggcggccaacctctcacacgccgcccaaaggattgtgcgggtccccattttgtaccacgagaactcgccggccagcgccttaggcttcggcctgccccacatgtccccccccttggtgggcttctccggcggcgtcagttaccccctgggcaccttccccgccgcctcccttcccttccttcgctcgcagatgacgggactcgtctgagcgcccacctgtgtcgggaccgcggccccgagccccctcccttggcttccagcttcaccctcggactttttctttccactttcaccattttccgcttttcgacttttatttaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]