ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-24 23:27:20, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_205533 1018 bp mRNA linear VRT 30-APR-2025 DEFINITION Gallus gallus H6 family homeobox 1 (HMX1), mRNA. ACCESSION NM_205533 VERSION NM_205533.3 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1018) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1018) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1018) AUTHORS Schulte,D. and Cepko,C.L. TITLE Two homeobox genes define the domain of EphA3 expression in the developing chick retina JOURNAL Development 127 (23), 5033-5045 (2000) PUBMED 11060230 REFERENCE 4 (bases 1 to 1018) AUTHORS Stadler,H.S., Murray,J.C., Leysens,N.J., Goodfellow,P.J. and Solursh,M. TITLE Phylogenetic conservation and physical mapping of members of the H6 homeobox gene family JOURNAL Mamm Genome 6 (6), 383-388 (1995) PUBMED 7647458 REFERENCE 5 (bases 1 to 1018) AUTHORS Stadler,H.S. and Solursh,M. TITLE Characterization of the homeobox-containing gene GH6 identifies novel regions of homeobox gene expression in the developing chick embryo JOURNAL Dev Biol 161 (1), 251-262 (1994) PUBMED 7904968 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000074.1. On Dec 3, 2021 this sequence version replaced NM_205533.2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript exon combination :: SRR13267649.35278.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3109051, SAMEA3109053 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-327 JAENSK010000074.1 33954095-33954421 c 328-1018 JAENSK010000074.1 33951761-33952451 c FEATURES Location/Qualifiers source 1..1018 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="4" /map="4" gene 1..1018 /gene="HMX1" /gene_synonym="GH6" /note="H6 family homeobox 1" /db_xref="CGNC:11629" /db_xref="GeneID:396546" exon 1..327 /gene="HMX1" /gene_synonym="GH6" /inference="alignment:Splign:2.1.0" CDS 78..899 /gene="HMX1" /gene_synonym="GH6" /note="homeo box (H6 family) 1; homeobox protein H6; homeobox (H6 family) 1" /codon_start=1 /product="homeobox protein HMX1" /protein_id="NP_990864.2" /db_xref="CGNC:11629" /db_xref="GeneID:396546" /translation="
MPDEATENAGSTSARVSSFFIEDLLGTEGGGGTRRAAAGGGGGRGAPRCGPHSPLRLGASGCPLRDAAVGWYRRAFLGCASPDTSDRDSPELPEDTERAGGGGRAAARGPAGGRQSSGGREEEEERGEEAGEAEQRAAGRKKKTRTVFSRSQVFQLESTFDVKRYLSSSERAGLAASLHLTETQVKIWFQNRRNKWKRQLAADLEAANLSHAAQRIVRVPILYHENSPASALGFGLPHMSPPLVGFSGGVSYPLGTFPAASLPFLRSQMTGLV"
misc_feature 501..671
/gene="HMX1"
/gene_synonym="GH6"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
exon 328..1018
/gene="HMX1"
/gene_synonym="GH6"
/inference="alignment:Splign:2.1.0"
ORIGIN
ccgcggggcagcggggagccgaggagccatcctccggcggagccgggaccccccctcccgcagctgttttaccgacgatgccggacgaagcgacggaaaacgccggctccacatctgcccgcgtctcgtcctttttcatcgaggacctgctgggcaccgaaggcggcggagggacgcggagggcggcggcgggaggcggaggtgggcgcggagctccgcgctgcggcccccactccccgctgcgcctcggagcctcgggctgcccgctccgcgacgccgccgtcggttggtaccgtcgagctttcttgggctgcgccagccccgacaccagcgaccgggactcgccggagctgcccgaggacacggagcgggcgggcggcggcgggcgggcggcggcgcggggccccgcgggcgggaggcagagctccggaggccgcgaggaagaggaggaacgcggcgaggaagcgggcgaagcggagcagcgagccgccggccgcaagaagaagacgcgcacggtgttcagccgcagccaggtcttccagctggagtccaccttcgacgtgaagcgctacctgagcagctccgagagggccggcctggccgcctcgctgcacctcaccgagacgcaggtgaagatttggttccagaaccgccgcaacaagtggaagcggcagctcgccgccgacctggaggcggccaacctctcacacgccgcccaaaggattgtgcgggtccccattttgtaccacgagaactcgccggccagcgccttaggcttcggcctgccccacatgtccccccccttggtgggcttctccggcggcgtcagttaccccctgggcaccttccccgccgcctcccttcccttccttcgctcgcagatgacgggactcgtctgagcgcccacctgtgtcgggaccgcggccccgagccccctcccttggcttccagcttcaccctcggactttttctttccactttcaccattttccgcttttcgacttttatttaaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]