GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-18 08:04:14, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NM_205491               2336 bp    mRNA    linear   VRT 01-MAY-2025
DEFINITION  Gallus gallus heat shock 70kDa protein 5 (glucose-regulated
            protein, 78kDa) (HSPA5), mRNA.
ACCESSION   NM_205491
VERSION     NM_205491.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 2336)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 2336)
  AUTHORS   Wang,L., Mei,M., Qin,A., Ye,J., Qian,K. and Shao,H.
  TITLE     Membrane-associated GRP78 helps subgroup J avian leucosis virus
            enter cells
  JOURNAL   Vet Res 47 (1), 92 (2016)
   PUBMED   27599847
  REMARK    GeneRIF: helps subgroup J avian leucosis virus enter cells
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2336)
  AUTHORS   Jeon,M., Choi,H., Lee,S.I., Kim,J.S., Park,M., Kim,K., Lee,S. and
            Byun,S.J.
  TITLE     GRP78 is required for cell proliferation and protection from
            apoptosis in chicken embryo fibroblast cells
  JOURNAL   Poult Sci 95 (5), 1129-1136 (2016)
   PUBMED   26944959
  REMARK    GeneRIF: These findings have important implications for the
            maintenance of chicken fibroblast cells through the inhibition of
            apoptosis and may lead to the development of new treatments for
            avian disease.
REFERENCE   4  (bases 1 to 2336)
  AUTHORS   Kong,L.N., Zhang,D.X., Ji,C.L., Zhang,X.Q. and Luo,Q.B.
  TITLE     Association analysis between SNPs in the 5'-flanking region of the
            chicken GRP78 gene, thermotolerance parameters, and tissue mRNA
            expression
  JOURNAL   Genet Mol Res 14 (2), 6110-6123 (2015)
   PUBMED   26125812
  REMARK    GeneRIF: Data indicate that mRNA expression level of GRP78 gene
            increased gradually under heat stress then decreased after a
            certain time suggesting that GRP78 mRNA expression is time- and
            tissue-dependent.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2336)
  AUTHORS   Lin,P.Y., Liu,H.J., Chang,C.D., Chen,Y.C., Chang,C.I. and Shih,W.L.
  TITLE     Avian reovirus S1133-induced apoptosis is associated with
            Bip/GRP79-mediated Bim translocation to the endoplasmic reticulum
  JOURNAL   Apoptosis 20 (4), 481-490 (2015)
   PUBMED   25576194
  REMARK    GeneRIF: BiP/GRP78 played critical roles and works upstream of
            JNK-Bim in response to the ARV S1133-mediated apoptosis process.
REFERENCE   6  (bases 1 to 2336)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 2336)
  AUTHORS   Sokolowski,B., Orchard,S., Harvey,M., Sridhar,S. and Sakai,Y.
  TITLE     Conserved BK channel-protein interactions reveal signals relevant
            to cell death and survival
  JOURNAL   PLoS One 6 (12), e28532 (2011)
   PUBMED   22174833
  REMARK    Erratum:[PLoS One. 2012;7(1).
            doi:10.1371/annotation/15e95626-9f5c-4882-ba78-826b80c48028]
REFERENCE   8  (bases 1 to 2336)
  AUTHORS   de la Rosa,E.J., Vega-Nunez,E., Morales,A.V., Serna,J., Rubio,E.
            and de Pablo,F.
  TITLE     Modulation of the chaperone heat shock cognate 70 by embryonic
            (pro)insulin correlates with prevention of apoptosis
  JOURNAL   Proc Natl Acad Sci U S A 95 (17), 9950-9955 (1998)
   PUBMED   9707581
REFERENCE   9  (bases 1 to 2336)
  AUTHORS   Stoeckle,M.Y., Sugano,S., Hampe,A., Vashistha,A., Pellman,D. and
            Hanafusa,H.
  TITLE     78-kilodalton glucose-regulated protein is induced in Rous sarcoma
            virus-transformed cells independently of glucose deprivation
  JOURNAL   Mol Cell Biol 8 (7), 2675-2680 (1988)
   PUBMED   2841586
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAENSK010000308.1.
            
            On Sep 23, 2021 this sequence version replaced NM_205491.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HAEK01008906.1, M27260.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN06140852, SAMN06140853
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-36                JAENSK010000308.1  9384782-9384817     c
            37-169              JAENSK010000308.1  9384464-9384596     c
            170-401             JAENSK010000308.1  9384027-9384258     c
            402-539             JAENSK010000308.1  9383657-9383794     c
            540-652             JAENSK010000308.1  9383337-9383449     c
            653-1043            JAENSK010000308.1  9382858-9383248     c
            1044-1281           JAENSK010000308.1  9382302-9382539     c
            1282-1449           JAENSK010000308.1  9381967-9382134     c
            1450-2336           JAENSK010000308.1  9380753-9381639     c
FEATURES             Location/Qualifiers
     source          1..2336
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="17"
                     /map="17"
     gene            1..2336
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /note="heat shock 70kDa protein 5 (glucose-regulated
                     protein, 78kDa)"
                     /db_xref="CGNC:667"
                     /db_xref="GeneID:396487"
     exon            1..36
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
     exon            37..169
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
     CDS             54..2012
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /EC_number="3.6.4.10"
                     /note="78 kDa glucose-regulated protein; biP; GRP-78; heat
                     shock 70 kDa protein 5; immunoglobulin heavy chain-binding
                     protein; HSP70 family protein 5; binding-immunoglobulin
                     protein; heat shock protein family A member 5; heat shock
                     protein 70 family protein 5; endoplasmic reticulum
                     chaperone BiP"
                     /codon_start=1
                     /product="endoplasmic reticulum chaperone BiP precursor"
                     /protein_id="NP_990822.1"
                     /db_xref="CGNC:667"
                     /db_xref="GeneID:396487"
                     /translation="
MRHLLLALLLLGGARADDEEKKEDVGTVVGIDLGTTYSCVGVFKNGRVEIIANDQGNRITPSYVAFTPEGERLIGDAAKNQLTSNPENTVFDAKRLIGRTWNDPSVQQDIKYLPFKVVEKKAKPHIQVDVGGGQTKTFAPEEISAMVLTKMKETAEAYLGKKVTHAVVTVPAYFNDAQRQATKDAGTIAGLNVMRIINEPTAAAIAYGLDKREGEKNILVFDLGGGTFDVSLLTIDNGVFEVVATNGDTHLGGEDFDQRVMEHFIKLYKKKTGKDVRKDNRAVQKLRREVEKAKRALSSQHQARIEIESFFEGEDFSETLTRAKFEELNMDLFRSTMKPVQKVLEDSDLKKSDIDEIVLVGGSTRIPKIQQLVKEFFNGKEPSRGINPDEAVAYGAAVQAGVLSGDQDTGDLVLLDVCPLTLGIETVGGVMTKLIPRNTVVPTKKSQIFSTASDNQPTVTIKVYEGERPLTKDNHLLGTFDLTGIPPAPRGVPQIEVTFEIDVNGILRVTAEDKGTGNKNKITITNDQNRLTPEEIERMVNDAEKFAEEDKKLKERIDARNELESYAYSLKNQIGDKEKLGGKLSSEDKETIEKAVEEKIEWLESHQDADIEDFKSKKKELEEVVQPIVSKLYGSAGPPPTGEEEAAEKDEL"
     sig_peptide     54..101
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     mat_peptide     102..2009
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /product="Endoplasmic reticulum chaperone BiP.
                     /id=PRO_0000013570"
                     /note="propagated from UniProtKB/Swiss-Prot (Q90593.1)"
     misc_feature    135..1952
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /note="Hsp70 protein; Region: HSP70; pfam00012"
                     /db_xref="CDD:394970"
     misc_feature    420..887
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /note="propagated from UniProtKB/Swiss-Prot (Q90593.1);
                     Region: Nucleotide-binding (NBD).
                     /evidence=ECO:0000250|UniProtKB:P11021"
     misc_feature    1272..1304
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /note="propagated from UniProtKB/Swiss-Prot (Q90593.1);
                     Region: Interdomain linker.
                     /evidence=ECO:0000250|UniProtKB:G3I8R9"
     misc_feature    1305..1547
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /note="propagated from UniProtKB/Swiss-Prot (Q90593.1);
                     Region: Substrate-binding (SBD).
                     /evidence=ECO:0000250|UniProtKB:P11021"
     misc_feature    1941..2009
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /note="propagated from UniProtKB/Swiss-Prot (Q90593.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1998..2009
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /note="propagated from UniProtKB/Swiss-Prot (Q90593.1);
                     Region: Prevents secretion from ER.
                     /evidence=ECO:0000255|PROSITE-ProRule:PRU10138"
     exon            170..401
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
     exon            402..539
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
     exon            540..652
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
     exon            653..1043
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
     exon            1044..1281
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
     exon            1282..1449
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
     exon            1450..2336
                     /gene="HSPA5"
                     /gene_synonym="GRP78; Hsc70"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agcggcagttggagacgcgacggttcgtgtgtgacgagcggcgagcgggcggcatgaggcacctcctgttggcgctgctgctgctgggcggcgcgcgggcggacgatgaggagaaaaaggaggacgtgggcacggtggtgggcatcgacctcggtaccacctattcttgtgtgggtgtattcaagaacggccgcgtggaaatcattgccaatgaccaggggaaccgcatcacgccatcctacgtggcgttcacgcctgagggggagcgcctgattggggatgcagccaagaaccagctgacatccaaccctgagaacactgtgtttgatgccaagcggctcataggccgcacctggaatgacccctctgtacagcaggacatcaagtatctgcccttcaaggttgttgaaaagaaggccaagccacatattcaggtcgatgttggtggtggacaaacaaaaacatttgctcctgaagaaatttctgccatggtcctgacaaagatgaaagaaactgcagaggcttatctgggcaagaaagttactcatgctgttgttactgtgccagcctacttcaatgatgctcagcgtcaggccacaaaagatgctggtaccattgctgggttgaacgtgatgcgcattattaatgagccaactgctgctgcaattgcatacggattggacaagagagagggtgaaaagaacatccttgtatttgacctgggtggtggaacttttgatgtctccctcctgacaattgacaacggagtctttgaagttgtggctacaaatggtgacacacacctgggtggagaagactttgaccagcgtgttatggagcacttcatcaaactctacaagaagaaaacaggaaaagatgtcaggaaggataacagagctgtacagaaactaagacgggaagtagagaaagcgaagcgggccctgtcatcccagcaccaagctagaattgaaatagaatccttttttgaaggagaggatttctctgagacgcttactcgtgccaaatttgaagaactgaatatggatctgttccgttctacgatgaagcctgttcagaaagttctggaagactctgacctaaagaagtctgatattgatgagattgttcttgttggtggttctactcgcatccccaaaatacaacaacttgttaaagagttcttcaatgggaaagagccttctcgtggcattaatccagatgaagctgtagcctatggtgcagctgttcaggctggtgttctctctggggaccaagacacaggtgacctggtgttgcttgatgtgtgtcctctgacacttggcattgagacagttggaggtgtaatgactaaactgatcccaagaaatactgttgttcctaccaagaagtctcagatcttttccacagcttctgacaatcagcccactgtgaccattaaggtctatgaaggtgaacgtcccctcaccaaggacaatcatcttctgggaacttttgatctgactggaatccctcctgctcctcgtggtgtcccacagattgaagttacctttgaaatagatgtgaatggaatccttcgtgtcacagctgaagacaaaggcactgggaacaaaaacaagatcacaattacaaatgatcagaatcggctaacaccagaggagattgagaggatggttaatgatgctgagaagtttgctgaggaagacaaaaagcttaaagaacgcattgatgcccggaatgagctggagagctatgcgtattctttgaagaatcaaattggggacaaagagaagctgggtggcaagctgtcatctgaagacaaagaaacaatagaaaaggcagtagaggaaaagatagagtggcttgaaagccatcaggatgcagacattgaagacttcaaatcaaagaagaaggagctggaggaagttgttcaaccaattgttagcaagctctatggaagtgcaggcccccctcccactggtgaagaagaagcagcagagaaggatgagttgtagatactggcatctctgaatgttgtgtgtatatattggactcaggaacacttgttaaaatattgaactcttaatttggaatgtaactttgaatcttcacttgtgagtggagctggaaatgctagcccgaagtggctgtttactgcttttcgttagcagttgcttgatgtctggggagggaagggtagcaggggtgggactgtacatgagaaatgggtttagaaatattggccatggaagcattctatttaacagcttggtcatgtgaatttggtgtagaacttttctacctgaagtgaccacaataaatttgttatttacactgga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]