2024-07-03 21:36:50, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_205434 1964 bp mRNA linear VRT 03-APR-2024 DEFINITION Gallus gallus homeobox D13 (HOXD13), mRNA. ACCESSION NM_205434 XM_429309 VERSION NM_205434.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1964) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1964) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1964) AUTHORS Bangs,F., Welten,M., Davey,M.G., Fisher,M., Yin,Y., Downie,H., Paton,B., Baldock,R., Burt,D.W. and Tickle,C. TITLE Identification of genes downstream of the Shh signalling in the developing chick wing and syn-expressed with Hoxd13 using microarray and 3D computational analysis JOURNAL Mech Dev 127 (9-12), 428-441 (2010) PUBMED 20708683 REMARK GeneRIF: Hoxd13 and Sall1 are syn-expressed in the posterior region of early chick wing buds together with 6 novel genes which are likely to be functionally related and represent secondary targets of Shh signalling. REFERENCE 4 (bases 1 to 1964) AUTHORS Rogina,B. and Upholt,W.B. TITLE Cloning of full coding chicken cDNAs for the homeobox-containing gene Hoxd-13 JOURNAL Nucleic Acids Res 21 (5), 1316 (1993) PUBMED 8096637 REFERENCE 5 (bases 1 to 1964) AUTHORS Izpisua-Belmonte,J.C., Tickle,C., Dolle,P., Wolpert,L. and Duboule,D. TITLE Expression of the homeobox Hox-4 genes and the specification of position in chick wing development JOURNAL Nature 350 (6319), 585-589 (1991) PUBMED 1673231 REFERENCE 6 (bases 1 to 1964) AUTHORS Nohno,T., Noji,S., Koyama,E., Ohyama,K., Myokai,F., Kuroiwa,A., Saito,T. and Taniguchi,S. TITLE Involvement of the Chox-4 chicken homeobox genes in determination of anteroposterior axial polarity during limb development JOURNAL Cell 64 (6), 1197-1205 (1991) PUBMED 1672266 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from L09550.1. On Aug 30, 2004 this sequence version replaced XM_429309.1. ##Evidence-Data-START## Transcript exon combination :: L09550.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3109051, SAMN08016554 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1964 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="7" /map="7" /breed="Leghorn" gene 1..1964 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="homeobox D13" /db_xref="CGNC:7049" /db_xref="GeneID:396415" CDS 11..916 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="homeobox protein hoxd13; homeobox protein Hox-4G; homeobox protein Hox-4.8; Hox D13" /codon_start=1 /product="homeobox protein Hox-D13" /protein_id="NP_990765.1" /db_xref="CGNC:7049" /db_xref="GeneID:396415" /translation="
MDGLRGDSSGGGGGGGTPGQCRNFLSSPVFGAAHTGRAAAAAAAAASGFAYAGGGERSGAAARPDPPAKDCPGSGAPPAAPALGYGYHFGNGYYSCRMSNGVGIQQNALKSPPHASIGGFPVEKYMDVSSLTSTSVPANEVSTRAKEVSSYQGYTNPYQHVPGYIDMVSTFGSGEPRHETYISMEGYQSWTLANGWNGQVYCAKDQTQSSHFWKSSFPGDVALNQPEMCVYRRGRKKRVPYTKLQLKELENEYAINKFINKDKRRRISAATNLSERQVTIWFQNRRVKDKKIVSKLKDNVS"
misc_feature 11..70 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="propagated from UniProtKB/Swiss-Prot (P24344.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 68..442 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="Hox protein A13 N terminal; Region: HoxA13_N; pfam12284" /db_xref="CDD:463521" misc_feature 173..235 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="propagated from UniProtKB/Swiss-Prot (P24344.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 713..883 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" polyA_site 1218 /gene="HOXD13" /gene_synonym="chox-4.8; chox-4G" /note="alternate" ORIGIN
gggctgggagatggacggactgcgcggcgacagcagcggcggcggcggcggcggcggcacccccgggcagtgccgtaactttctctcctcgcccgttttcggcgcggcgcacacgggccgcgcggccgccgccgccgccgccgccgcctcggggttcgcctacgccggcggaggggagcgctcgggggcggcggcgcggcccgaccccccggccaaggactgcccgggctccggcgcgccgcccgccgcccccgcgctcggctacgggtatcactttggcaacggatactatagctgcaggatgtccaacggggttgggatccagcagaacgccctgaagtctcccccccatgcctccattggcggctttcccgtggaaaagtacatggacgtctccagtctgaccagcacgagtgtccccgccaatgaagtctccaccagggctaaagaagtgtcctcctaccagggctatacaaacccctaccagcacgttcctgggtacatagacatggtctcaacgtttggctctggggaaccgagacacgaaacgtacatatccatggagggctatcagtcctggactctggctaatggctggaacggccaggtgtactgtgccaaagatcagacacagagctcgcacttctggaaatcgtcctttccaggggacgttgcactaaaccagcccgagatgtgcgtctaccggcgcgggaggaagaagagagtgccctacaccaagctccagcttaaggaactcgagaacgaatacgccattaacaagttcattaacaaggacaagaggcgaaggatatccgcggccacgaacctgtccgaacgccaggtcaccatttggtttcagaacaggagggtgaaggataagaaaatagtctccaaactgaaagacaacgtttcttgatcgattccttgcggacagtggcggatatacaacctccgtttacgaccagctgcggacttttggaaagacttgaaaatatatttaatattttttttctcttctccttccagcggtggcgaagtttcgtgaattgttttctattcccgtgaaagccggcgttgttctctcggtggaagggagcgccgacaagccgtgactttagcgttgtttcttccttcctttttttaaaaaaaaataatattaatattaattatattttctatccttccctctaggccagtataaacgaatttaaacgtgtcgaacggttccatttataactttcttaaatgcttatctctttggggaggggacccggggtttttatctccgaacgtcggccggtgcccgaaagtgtcggactcgatttggtgtattggtcggaaaacgcgagtgagcgcgttcccgcagtcactgccggcaaaagccgcattgccggagtccgcacggggctccgcggatgtcggaagcagcggctccggaagggaattgtttgcactgcagtgggatcgctctttttattctttatgatttgattttgctggcgggcaatctgctaccggcttttcctggggtacggagcgcggcctcggctcctctcgttggatccgaaggggcagcgatgctccccgcagcagcgcccgggggtccctccggccgccccgtcccatcccgtcccgtcccgtcccgtcccgtcccgaggtgcgcacgtacctccgtgcggaccccgcgtgcgcataacgcacttcccggtcggagaagtgaagttcaccgctaactttcagtttgcaaaactaaacgggtgttaatgacagaagcaataaatgattcgtttcaaaagatgccataatttatgtaggccgaaaggctgggactcggttgggtttttgtaattttaaacctagcgtgcatgttatgctatacgcagggaggtcagctcctgggaaagagaagcgatgtcctccctgttcatgtgcctcgtgtaattattaaatggtgtgtgtttcga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]