GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-28 00:45:32, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_205267               1268 bp    mRNA    linear   VRT 26-JUN-2025
DEFINITION  Gallus gallus nucleophosmin (NPM1), mRNA.
ACCESSION   NM_205267
VERSION     NM_205267.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1268)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1268)
  AUTHORS   Duan,Z., Chen,J., Xu,H., Zhu,J., Li,Q., He,L., Liu,H., Hu,S. and
            Liu,X.
  TITLE     The nucleolar phosphoprotein B23 targets Newcastle disease virus
            matrix protein to the nucleoli and facilitates viral replication
  JOURNAL   Virology 452-453, 212-222 (2014)
   PUBMED   24606698
  REMARK    GeneRIF: Phosphoprotein B23 targets Newcastle disease virus matrix
            protein to the nucleoli and facilitates viral replication.
REFERENCE   3  (bases 1 to 1268)
  AUTHORS   Duan,Z., Chen,J., He,L., Xu,H., Li,Q., Hu,S. and Liu,X.
  TITLE     [Matrix protein of Newcastle disease virus interacts with avian
            nucleophosmin B23. 1 in HEK-293T cells]
  JOURNAL   Wei Sheng Wu Xue Bao 53 (7), 730-736 (2013)
   PUBMED   24195380
  REMARK    GeneRIF: Matrix protein of Newcastle disease virus interacts with
            chicken nucleophosmin B23.1.
REFERENCE   4  (bases 1 to 1268)
  AUTHORS   Mukudai,Y., Kubota,S., Kawaki,H., Kondo,S., Eguchi,T.,
            Sumiyoshi,K., Ohgawara,T., Shimo,T. and Takigawa,M.
  TITLE     Posttranscriptional regulation of chicken ccn2 gene expression by
            nucleophosmin/B23 during chondrocyte differentiation
  JOURNAL   Mol Cell Biol 28 (19), 6134-6147 (2008)
   PUBMED   18678650
  REMARK    GeneRIF: The present study reveals a novel aspect of NPM/B23 as a
            key player in the posttranscriptional regulation of ccn2 mRNA
            during the differentiation of chondrocytes.
REFERENCE   5  (bases 1 to 1268)
  AUTHORS   Hubbard,S.J., Grafham,D.V., Beattie,K.J., Overton,I.M.,
            McLaren,S.R., Croning,M.D., Boardman,P.E., Bonfield,J.K.,
            Burnside,J., Davies,R.M., Farrell,E.R., Francis,M.D.,
            Griffiths-Jones,S., Humphray,S.J., Hyland,C., Scott,C.E., Tang,H.,
            Taylor,R.G., Tickle,C., Brown,W.R., Birney,E., Rogers,J. and
            Wilson,S.A.
  TITLE     Transcriptome analysis for the chicken based on 19,626 finished
            cDNA sequences and 485,337 expressed sequence tags
  JOURNAL   Genome Res 15 (1), 174-183 (2005)
   PUBMED   15590942
REFERENCE   6  (bases 1 to 1268)
  AUTHORS   Maridor,G., Krek,W. and Nigg,E.A.
  TITLE     Structure and developmental expression of chicken nucleolin and
            NO38: coordinate expression of two abundant non-ribosomal nucleolar
            proteins
  JOURNAL   Biochim Biophys Acta 1049 (2), 126-133 (1990)
   PUBMED   2114180
REFERENCE   7  (bases 1 to 1268)
  AUTHORS   Maridor,G. and Nigg,E.A.
  TITLE     cDNA sequences of chicken nucleolin/C23 and NO38/B23, two major
            nucleolar proteins
  JOURNAL   Nucleic Acids Res 18 (5), 1286 (1990)
   PUBMED   2320420
REFERENCE   8  (bases 1 to 1268)
  AUTHORS   Borer,R.A., Lehner,C.F., Eppenberger,H.M. and Nigg,E.A.
  TITLE     Major nucleolar proteins shuttle between nucleus and cytoplasm
  JOURNAL   Cell 56 (3), 379-390 (1989)
   PUBMED   2914325
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAENSK010000256.1.
            
            On Sep 23, 2021 this sequence version replaced NM_205267.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HAEK01012407.1, HAEK01009853.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA103992290, SAMEA103992323
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-127               JAENSK010000256.1  1518579-1518705     c
            128-207             JAENSK010000256.1  1517973-1518052     c
            208-327             JAENSK010000256.1  1515094-1515213     c
            328-421             JAENSK010000256.1  1514373-1514466     c
            422-525             JAENSK010000256.1  1513755-1513858     c
            526-587             JAENSK010000256.1  1513215-1513276     c
            588-642             JAENSK010000256.1  1512778-1512832     c
            643-732             JAENSK010000256.1  1511598-1511687     c
            733-834             JAENSK010000256.1  1510689-1510790     c
            835-909             JAENSK010000256.1  1508837-1508911     c
            910-1268            JAENSK010000256.1  1507498-1507856     c
FEATURES             Location/Qualifiers
     source          1..1268
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="13"
                     /map="13"
     gene            1..1268
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="nucleophosmin"
                     /db_xref="CGNC:49698"
                     /db_xref="GeneID:396203"
     exon            1..127
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     CDS             64..948
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="nucleolar phosphoprotein B23; NPM; numatrin;
                     nucleolar protein NO38; nucleophosmin (nucleolar
                     phosphoprotein B23, numatrin)"
                     /codon_start=1
                     /product="nucleophosmin"
                     /protein_id="NP_990598.2"
                     /db_xref="CGNC:49698"
                     /db_xref="GeneID:396203"
                     /translation="
MEDSAMDMESMGPLRPQTFLFGCELKAEKEYQFKVDDEENEHQLSLRTVTLGAGAKDELHVVEAEALDYEGNPTKVVLASLKMSVQPTVSLGGFEITPPVVLRLKCGSGPVYVSGQHLVALEEEPESEDEEEDTKIGNASTKRPASGGGAKTPQKKPKLSEDDEDDDEDEDDDEDDEDDLDDDEEEIKTPMKKPAREPAGKNMQKAKQNGKDSKPSTPASKTKTPDSKKDKSLTPKTPKVPLSLEEIKAKMQASVDKGCSLPKLEPKFANYVKNCFRTEDQKVIQALWQWRQTL"
     misc_feature    121..420
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="Nucleoplasmin/nucleophosmin domain; Region:
                     Nucleoplasmin; pfam03066"
                     /db_xref="CDD:460792"
     misc_feature    232..234
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="Interaction between pentamers.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P16039.1); other site"
     misc_feature    307..309
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="Interaction between pentamers.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P16039.1); other site"
     misc_feature    424..795
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="propagated from UniProtKB/Swiss-Prot (P16039.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    520..537
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="propagated from UniProtKB/Swiss-Prot (P16039.1);
                     Region: Nuclear localization signal.
                     /evidence=ECO:0000255"
     misc_feature    631..651
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="propagated from UniProtKB/Swiss-Prot (P16039.1);
                     Region: Nuclear localization signal.
                     /evidence=ECO:0000255"
     misc_feature    796..942
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /note="Nucleophosmin C-terminal domain; Region: NPM1-C;
                     pfam16276"
                     /db_xref="CDD:465081"
     exon            128..207
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            208..327
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            328..421
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            422..525
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            526..587
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            588..642
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            643..732
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            733..834
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            835..909
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
     exon            910..1268
                     /gene="NPM1"
                     /gene_synonym="NO38"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
agtgcgcgtccgtccgcagcgccgcatcccgtacagctcctcccgcgcgagcaggccgagaagatggaggacagcgccatggacatggagagcatgggcccgctgcgcccgcagaccttcctcttcggctgcgagcttaaagcagagaaggaatatcagttcaaagtagatgatgaggaaaacgagcatcagctgtccttgagaacggttacattaggggctggagccaaagacgaattacatgttgtagaagcagaagcactggactacgaaggcaacccaactaaagtagtactggcatctctgaaaatgtctgtgcagcctacagtttcactaggtggatttgagatcacaccaccagttgtcttgaggttaaaatgtggttcggggcctgtttatgtcagtggtcagcatcttgtagcattagaggaagagccagaatcagaggatgaggaggaggatacaaaaatagggaatgcttcaacaaagagaccagcaagtggaggaggagctaaaacaccacagaaaaaaccaaaattatcagaagatgatgaggacgatgatgaagatgaggatgatgatgaggatgatgaagacgacttggatgatgatgaggaggagattaaaacaccaatgaagaaacctgcccgcgagcctgcaggaaaaaatatgcagaaagcaaagcaaaatggaaaagactcaaagccgtccacaccagcatctaaaacaaaaactccagattccaagaaggacaaatctctaactccaaaaacaccgaaagttcctctgtcgttagaggagatcaaagcaaaaatgcaggcctccgtagacaagggttgttcccttcctaagctggagcccaaatttgccaactatgttaagaattgcttcaggacggaggaccaaaaggtcattcaagctctctggcagtggagacagactctgtaagagaacaatttaaacagtttgttaaagtctgcagtcttacttctgtaaccattatttggctgttctttttacaaatgctgaaagagctttccctacagtgtctgataaatgtcatccagattaccttgccaagaatgtgttgtccaaaatgcctgtttagtttttaaagatgggactccaccctcagcttcattttaagtatgtatggaatgttttgataaggcatggtggtgtggtggtggtggtcagacaaatggaagtggtgggaagactaaatgtacgtggaaaaaaaaaataaaatttagtattttaataaagta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]