2025-09-17 18:04:38, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_205195 1163 bp mRNA linear VRT 23-JUN-2025 DEFINITION Gallus gallus pyrimidinergic receptor P2Y6 (P2RY6), mRNA. ACCESSION NM_205195 VERSION NM_205195.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1163) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1163) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1163) AUTHORS Webb,T.E., Henderson,D., King,B.F., Wang,S., Simon,J., Bateson,A.N., Burnstock,G. and Barnard,E.A. TITLE A novel G protein-coupled P2 purinoceptor (P2Y3) activated preferentially by nucleoside diphosphates JOURNAL Mol Pharmacol 50 (2), 258-265 (1996) PUBMED 8700132 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from X98283.1. ##Evidence-Data-START## Transcript is intronless :: X98283.1 [ECO:0000345] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1163 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="1" /map="1" gene 1..1163 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="pyrimidinergic receptor P2Y6" /db_xref="CGNC:13017" /db_xref="GeneID:396114" exon 1..1163 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /inference="alignment:Splign:2.1.0" misc_feature 15..17 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="upstream in-frame stop codon" CDS 27..1013 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="G protein-coupled P2 receptor; nucleoside diphosphate receptor; pyrimidinergic receptor P2Y, G-protein coupled, 6" /codon_start=1 /product="P2Y purinoceptor 3" /protein_id="NP_990526.1" /db_xref="CGNC:13017" /db_xref="GeneID:396114" /translation="
MSMANFTGGRNSCTFHEEFKQVLLPLVYSVVFLLGLPLNAVVIGQIWLARKALTRTTIYMLNLAMADLLYVCSLPLLIYNYTQKDYWPFGDFTCKFVRFQFYTNLHGSILFLTCISVQRYMGICHPLASWHKKKGKKLTWLVCAAVWFIVIAQCLPTFVFASTGTQRNRTVCYDLSPPDRSTSYFPYGITLTITGFLLPFAAILACYCSMARILCQKDELIGLAVHKKKDKAVRMIIIVVIVFSISFFPFHLTKTIYLIVRSSASLPCPTLQAFAIAYKCTRPFASMNSVLDPILFYFTQRKFRESTRYLLDKMSSKWRQDHCISYGS"
misc_feature 39..41 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q98907.1); glycosylation site" misc_feature 90..947 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="P2Y purinoceptor 6, member of the class A family of seven-transmembrane G protein-coupled receptors; Region: 7tmA_P2Y6; cd15379" /db_xref="CDD:320501" misc_feature 90..173 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="TM helix 1 [structural motif]; Region: TM helix 1" /db_xref="CDD:320501" misc_feature 93..155 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="propagated from UniProtKB/Swiss-Prot (Q98907.1); transmembrane region" misc_feature 192..269 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="TM helix 2 [structural motif]; Region: TM helix 2" /db_xref="CDD:320501" misc_feature 198..260 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="propagated from UniProtKB/Swiss-Prot (Q98907.1); transmembrane region" misc_feature order(255..257,264..269,306..323,327..332,339..341, 477..479,483..497,537..539,543..551,576..578,585..593, 597..605,609..614,765..767,774..779,783..788,795..797, 846..851,855..863,870..872,879..884) /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="putative ligand binding pocket [chemical binding]; other site" /db_xref="CDD:320501" misc_feature 306..398 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="TM helix 3 [structural motif]; Region: TM helix 3" /db_xref="CDD:320501" misc_feature 315..377 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="propagated from UniProtKB/Swiss-Prot (Q98907.1); transmembrane region" misc_feature 435..503 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="TM helix 4 [structural motif]; Region: TM helix 4" /db_xref="CDD:320501" misc_feature 444..506 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="propagated from UniProtKB/Swiss-Prot (Q98907.1); transmembrane region" misc_feature 576..665 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="TM helix 5 [structural motif]; Region: TM helix 5" /db_xref="CDD:320501" misc_feature 594..656 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="propagated from UniProtKB/Swiss-Prot (Q98907.1); transmembrane region" misc_feature 705..797 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="TM helix 6 [structural motif]; Region: TM helix 6" /db_xref="CDD:320501" misc_feature 720..782 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="propagated from UniProtKB/Swiss-Prot (Q98907.1); transmembrane region" misc_feature 849..926 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="TM helix 7 [structural motif]; Region: TM helix 7" /db_xref="CDD:320501" misc_feature 852..920 /gene="P2RY6" /gene_synonym="P2RY3; P2Y3" /note="propagated from UniProtKB/Swiss-Prot (Q98907.1); transmembrane region" ORIGIN
ggcgcttcacccagtaaagagggaccatgagcatggccaacttcacgggggggaggaactcgtgcaccttccatgaggaattcaagcaggtcctgctgcccctggtctactcagtggtgttcctactggggctgccactcaatgccgttgtcattgggcagatctggctggcccgcaaggcgttgacccgcaccaccatctacatgctgaacctggccatggccgacctgctttatgtctgctccctccctctcctcatctacaactacacccagaaggattactggccctttggggacttcacctgcaaattcgtccgcttccagttctacaccaacctgcacggcagcatcctcttcctcacctgcatcagcgtccagcgctacatggggatctgccaccccttggcctcgtggcacaaaaagaagggaaagaagctgacgtggctggtgtgtgctgccgtgtggttcatcgtcatcgcccagtgcctgcccacctttgtcttcgcctccaccggcacgcagaggaatcgcactgtctgctatgacctgagccccccggaccgctccacatcctacttcccctatggcatcacgttgaccatcactggcttcctgctgcccttcgcagccatcctggcctgctactgcagcatggcccgcatcctgtgccagaaagacgagctgattggcttggcggtgcacaagaagaaggacaaggccgtgcgcatgatcatcatcgttgtcatcgtcttctccatcagcttcttccccttccacctcaccaagaccatctacctgatcgtccgctcctcagccagcttgccctgccctaccctgcaggcttttgccattgcctacaagtgcacgcggccctttgccagcatgaacagcgtcctcgaccccatcctcttctacttcacccagcgcaagtttcgtgagagcacccgctatctcctggacaagatgagctccaagtggcggcaagaccactgcatcagctacggctcctaggtggacgaggccacctcggtgtcaccggggctgggcatggagcaatttgggttgaagctgcatggtgcggagatggggatgagcccagagtgctgcgggtgccccatctctggaggtgttggagattagattggatggggctctgggccc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]