GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-18 20:56:33, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_205195               1163 bp    mRNA    linear   VRT 23-JUN-2025
DEFINITION  Gallus gallus pyrimidinergic receptor P2Y6 (P2RY6), mRNA.
ACCESSION   NM_205195
VERSION     NM_205195.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1163)
  AUTHORS   Tang,H., Finn,R.D. and Thomas,P.D.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1163)
  AUTHORS   Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C.,
            Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S.
  TITLE     Manual GO annotation of predictive protein signatures: the InterPro
            approach to GO curation
  JOURNAL   Database (Oxford) 2012, bar068 (2012)
   PUBMED   22301074
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1163)
  AUTHORS   Webb,T.E., Henderson,D., King,B.F., Wang,S., Simon,J.,
            Bateson,A.N., Burnstock,G. and Barnard,E.A.
  TITLE     A novel G protein-coupled P2 purinoceptor (P2Y3) activated
            preferentially by nucleoside diphosphates
  JOURNAL   Mol Pharmacol 50 (2), 258-265 (1996)
   PUBMED   8700132
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from X98283.1.
            
            ##Evidence-Data-START##
            Transcript is intronless :: X98283.1 [ECO:0000345]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1163
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="1"
                     /map="1"
     gene            1..1163
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="pyrimidinergic receptor P2Y6"
                     /db_xref="CGNC:13017"
                     /db_xref="GeneID:396114"
     exon            1..1163
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    15..17
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="upstream in-frame stop codon"
     CDS             27..1013
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="G protein-coupled P2 receptor; nucleoside
                     diphosphate receptor; pyrimidinergic receptor P2Y,
                     G-protein coupled, 6"
                     /codon_start=1
                     /product="P2Y purinoceptor 3"
                     /protein_id="NP_990526.1"
                     /db_xref="CGNC:13017"
                     /db_xref="GeneID:396114"
                     /translation="
MSMANFTGGRNSCTFHEEFKQVLLPLVYSVVFLLGLPLNAVVIGQIWLARKALTRTTIYMLNLAMADLLYVCSLPLLIYNYTQKDYWPFGDFTCKFVRFQFYTNLHGSILFLTCISVQRYMGICHPLASWHKKKGKKLTWLVCAAVWFIVIAQCLPTFVFASTGTQRNRTVCYDLSPPDRSTSYFPYGITLTITGFLLPFAAILACYCSMARILCQKDELIGLAVHKKKDKAVRMIIIVVIVFSISFFPFHLTKTIYLIVRSSASLPCPTLQAFAIAYKCTRPFASMNSVLDPILFYFTQRKFRESTRYLLDKMSSKWRQDHCISYGS"
     misc_feature    39..41
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q98907.1); glycosylation site"
     misc_feature    90..947
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="P2Y purinoceptor 6, member of the class A family of
                     seven-transmembrane G protein-coupled receptors; Region:
                     7tmA_P2Y6; cd15379"
                     /db_xref="CDD:320501"
     misc_feature    90..173
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="TM helix 1 [structural motif]; Region: TM helix 1"
                     /db_xref="CDD:320501"
     misc_feature    93..155
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q98907.1);
                     transmembrane region"
     misc_feature    192..269
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="TM helix 2 [structural motif]; Region: TM helix 2"
                     /db_xref="CDD:320501"
     misc_feature    198..260
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q98907.1);
                     transmembrane region"
     misc_feature    order(255..257,264..269,306..323,327..332,339..341,
                     477..479,483..497,537..539,543..551,576..578,585..593,
                     597..605,609..614,765..767,774..779,783..788,795..797,
                     846..851,855..863,870..872,879..884)
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="putative ligand binding pocket [chemical binding];
                     other site"
                     /db_xref="CDD:320501"
     misc_feature    306..398
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="TM helix 3 [structural motif]; Region: TM helix 3"
                     /db_xref="CDD:320501"
     misc_feature    315..377
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q98907.1);
                     transmembrane region"
     misc_feature    435..503
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="TM helix 4 [structural motif]; Region: TM helix 4"
                     /db_xref="CDD:320501"
     misc_feature    444..506
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q98907.1);
                     transmembrane region"
     misc_feature    576..665
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="TM helix 5 [structural motif]; Region: TM helix 5"
                     /db_xref="CDD:320501"
     misc_feature    594..656
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q98907.1);
                     transmembrane region"
     misc_feature    705..797
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="TM helix 6 [structural motif]; Region: TM helix 6"
                     /db_xref="CDD:320501"
     misc_feature    720..782
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q98907.1);
                     transmembrane region"
     misc_feature    849..926
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="TM helix 7 [structural motif]; Region: TM helix 7"
                     /db_xref="CDD:320501"
     misc_feature    852..920
                     /gene="P2RY6"
                     /gene_synonym="P2RY3; P2Y3"
                     /note="propagated from UniProtKB/Swiss-Prot (Q98907.1);
                     transmembrane region"
ORIGIN      
ggcgcttcacccagtaaagagggaccatgagcatggccaacttcacgggggggaggaactcgtgcaccttccatgaggaattcaagcaggtcctgctgcccctggtctactcagtggtgttcctactggggctgccactcaatgccgttgtcattgggcagatctggctggcccgcaaggcgttgacccgcaccaccatctacatgctgaacctggccatggccgacctgctttatgtctgctccctccctctcctcatctacaactacacccagaaggattactggccctttggggacttcacctgcaaattcgtccgcttccagttctacaccaacctgcacggcagcatcctcttcctcacctgcatcagcgtccagcgctacatggggatctgccaccccttggcctcgtggcacaaaaagaagggaaagaagctgacgtggctggtgtgtgctgccgtgtggttcatcgtcatcgcccagtgcctgcccacctttgtcttcgcctccaccggcacgcagaggaatcgcactgtctgctatgacctgagccccccggaccgctccacatcctacttcccctatggcatcacgttgaccatcactggcttcctgctgcccttcgcagccatcctggcctgctactgcagcatggcccgcatcctgtgccagaaagacgagctgattggcttggcggtgcacaagaagaaggacaaggccgtgcgcatgatcatcatcgttgtcatcgtcttctccatcagcttcttccccttccacctcaccaagaccatctacctgatcgtccgctcctcagccagcttgccctgccctaccctgcaggcttttgccattgcctacaagtgcacgcggccctttgccagcatgaacagcgtcctcgaccccatcctcttctacttcacccagcgcaagtttcgtgagagcacccgctatctcctggacaagatgagctccaagtggcggcaagaccactgcatcagctacggctcctaggtggacgaggccacctcggtgtcaccggggctgggcatggagcaatttgggttgaagctgcatggtgcggagatggggatgagcccagagtgctgcgggtgccccatctctggaggtgttggagattagattggatggggctctgggccc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]