2024-09-28 09:27:20, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS NM_204768 2186 bp mRNA linear VRT 03-APR-2024 DEFINITION Gallus gallus visual system homeobox 2 (VSX2), mRNA. ACCESSION NM_204768 VERSION NM_204768.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 2186) AUTHORS Tang,H., Finn,R.D. and Thomas,P.D. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 2186) AUTHORS Wang,Z., Yasugi,S. and Ishii,Y. TITLE Chx10 functions as a regulator of molecular pathways controlling the regional identity in the primordial retina JOURNAL Dev Biol 413 (1), 104-111 (2016) PUBMED 27001188 REMARK GeneRIF: Chx10 can function as a cell autonomous regulator of the regional identity in the primordial retina, presumably through a downstream transcriptional cascade REFERENCE 3 (bases 1 to 2186) AUTHORS Burge,S., Kelly,E., Lonsdale,D., Mutowo-Muellenet,P., McAnulla,C., Mitchell,A., Sangrador-Vegas,A., Yong,S.Y., Mulder,N. and Hunter,S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 2186) AUTHORS Dorval,K.M., Bobechko,B.P., Fujieda,H., Chen,S., Zack,D.J. and Bremner,R. TITLE CHX10 targets a subset of photoreceptor genes JOURNAL J Biol Chem 281 (2), 744-751 (2006) PUBMED 16236706 REMARK GeneRIF: CHX10 may target specific motifs to inhibit rod photoreceptor gene expression in bipolar cells REFERENCE 5 (bases 1 to 2186) AUTHORS Rowan,S. and Cepko,C.L. TITLE A POU factor binding site upstream of the Chx10 homeobox gene is required for Chx10 expression in subsets of retinal progenitor cells and bipolar cells JOURNAL Dev Biol 281 (2), 240-255 (2005) PUBMED 15893976 REMARK GeneRIF: Chx10 expression in subsets of retinal progenitor cells and bipolar ells requires a POU factor binding site upstream of the Chx10 gene REFERENCE 6 (bases 1 to 2186) AUTHORS Dorval,K.M., Bobechko,B.P., Ahmad,K.F. and Bremner,R. TITLE Transcriptional activity of the paired-like homeodomain proteins CHX10 and VSX1 JOURNAL J Biol Chem 280 (11), 10100-10108 (2005) PUBMED 15647262 REMARK GeneRIF: CHX10 and VSX1 may control retinal bipolar cell specification or differentiation by repressing genes required for the development of other cell types REFERENCE 7 (bases 1 to 2186) AUTHORS Chen,C.M. and Cepko,C.L. TITLE Expression of Chx10 and Chx10-1 in the developing chicken retina JOURNAL Mech Dev 90 (2), 293-297 (2000) PUBMED 10640715 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF178671.1. ##Evidence-Data-START## Transcript exon combination :: AF178671.1, SRR13267659.198103.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3109051 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..2186 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="5" /map="5" gene 1..2186 /gene="VSX2" /gene_synonym="CHX10" /note="visual system homeobox 2" /db_xref="CGNC:7768" /db_xref="GeneID:395536" exon 1..435 /gene="VSX2" /gene_synonym="CHX10" /inference="alignment:Splign:2.1.0" CDS 9..1142 /gene="VSX2" /gene_synonym="CHX10" /note="homeobox protein Chx10; ceh-10 homeodomain containing homolog; ceh-10 homeo domain containing homolog" /codon_start=1 /product="visual system homeobox 2" /protein_id="NP_990099.1" /db_xref="CGNC:7768" /db_xref="GeneID:395536" /translation="
MTGKAGAALAPSLPGKPKPDGAAAAAPPPPPPAAGAKPSSGPTPPRCTGFGIQEILGLNKEPPSHPRAALDSLPAGHLLAARSVLSPAGVGGVGMGLLGAGGIPGFYAQPTFLEVLSDPQSVHLQPLARAPGQLDSSQTASSDSEDVSSSDRKMSKSSLNQSKKRKKRRHRTIFTSYQLEELEKAFNEAHYPDVYAREMLAMKTELPEDRIQVWFQNRRAKWRKREKCWGRSSVMAEYGLYGAMVRHSIPLPESILKSAKDGIMESCAPWLLGMHKKSLEAAAEAGRKTEVERQALPKLDKGDKEERGSDPKTAISQEELRENSIAALRAKAQEHSTKVLGTIAGDTPRKPEKGEEVAEDERQTEKSSASQKEEKLI"
misc_feature 9..158 /gene="VSX2" /gene_synonym="CHX10" /note="propagated from UniProtKB/Swiss-Prot (Q9IAL1.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 393..518 /gene="VSX2" /gene_synonym="CHX10" /note="propagated from UniProtKB/Swiss-Prot (Q9IAL1.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 522..680 /gene="VSX2" /gene_synonym="CHX10" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" misc_feature 861..1139 /gene="VSX2" /gene_synonym="CHX10" /note="propagated from UniProtKB/Swiss-Prot (Q9IAL1.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 963..1019 /gene="VSX2" /gene_synonym="CHX10" /note="OAR motif; Region: OAR; pfam03826" /db_xref="CDD:461067" misc_feature 975..1016 /gene="VSX2" /gene_synonym="CHX10" /note="propagated from UniProtKB/Swiss-Prot (Q9IAL1.1); Region: OAR. /evidence=ECO:0000255|PROSITE-ProRule:PRU00138" exon 436..520 /gene="VSX2" /gene_synonym="CHX10" /inference="alignment:Splign:2.1.0" exon 521..644 /gene="VSX2" /gene_synonym="CHX10" /inference="alignment:Splign:2.1.0" exon 645..825 /gene="VSX2" /gene_synonym="CHX10" /inference="alignment:Splign:2.1.0" exon 826..2186 /gene="VSX2" /gene_synonym="CHX10" /inference="alignment:Splign:2.1.0" ORIGIN
gccgcagcatgacgggcaaagcgggcgcggcgctggcccccagcctgcctggcaagcccaagcccgacggcgcggccgccgccgccccgccgccgccgccccccgcggcgggagccaagcccagctccgggcccacccctcctcgctgcaccggcttcggcatccaggagatcctgggcttgaacaaggaaccgccgtcgcacccgcgggccgccctggactcgctgcccgccgggcacctgctggcggcccgctccgtcctcagccccgccggggtgggcggcgtgggcatggggctgctgggggccggaggcatccccggcttctacgcgcagcccacctttctggaggtgctctccgacccgcagagcgtccacctgcagcctttggcccgagcccccgggcagctggacagcagccagacggccagctcagattccgaggatgtctcctccagcgaccgcaaaatgtccaaatcttccctcaaccagagcaagaaacgaaagaagaggcggcacaggacaatcttcacatcctaccaactggaagagctggaaaaggccttcaatgaggctcactaccctgatgtgtatgctagagagatgctggccatgaaaacagagctgccagaagacaggatacaggtctggttccagaaccgccgggccaagtggcggaagcgagagaagtgctggggccggagcagcgtgatggctgagtatgggctctatggagccatggtgcgccactccatcccgctgcctgagtccatcctcaagtcagccaaggacggcatcatggagtcctgcgccccatggctcctggggatgcacaaaaagtctctggaggcagcggctgaggcggggaggaagacggaggtggagcgccaggccctgcccaagcttgacaagggtgacaaggaagagaggggctcggatcccaaaaccgccatttcccaggaggaactgagagaaaacagcattgccgccctcagggccaaagctcaggagcacagcaccaaagtcctggggaccattgcgggggacaccccgaggaagccggaaaaaggggaggaagtggcagaggatgagaggcagacagagaagtccagtgcatcacagaaagaggagaagctgatctagggggacagaggctgcggaagccagccctgacagatactgtgtcctctgggggtcacagcccctctgatggccaggcctggcacccacccagggtgtggggccctggtttcttcacgtggggctaccccaagggtaccccaggctaccccagcctgctcccctgaagcgcagcctgtacttcactcctctactctttgggctttccttaccccagcccatccccatctccatcgtcaccccagggcaggctgcggctccaggtccctctggttgcggtcctgggcctagcctaaggtaccatccagccccctccaggccggtgaagcccagatccccttcacctcacgccccatcccgctgtgttccacaccccaggggaccccactgcccctggcacgatgagcccatggccctgtgtgtgtgaaacgctgagctacttggctctcccagctcagcactgacagctgctgggatggggctgctggtttggagtggctgatttgtgcctccattacgtgaggaaacgcaggtttagcttgcagatgccatgccccgttcccagctcacagctccagtgacctcagcctacaccgtcatctccccctatcgcactcggaggccagtgccacacacagctaaagcctctcaggctagacaacattttcccaaggtatttattgaagtaaattgccctgctctccttctgagcctgaagggaatgacagccatgcagatgcacccccggcacacactgtaatgtgtacatacgtctcctcactgacccatgtgtgcacgcagacccacgcagccaaacccgctgtacttcacagcatcccgtgctgacattgcccttctatcccagccaggcaccctctccccagagctgctgtttttattctgtcagaagtaaccccttccatccagccccatctgtctttgtcccccgtttgtttgacgtgttagattatagcccacgctgtgtaaataatgtacatacagtgagaaaagaattcagtattgaggtgtttgagatatggagctgta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]